ID: 1133707709

View in Genome Browser
Species Human (GRCh38)
Location 16:8370951-8370973
Sequence GCATAGCCAAGGCCATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133707709_1133707714 25 Left 1133707709 16:8370951-8370973 CCTTCCAATGGCCTTGGCTATGC No data
Right 1133707714 16:8370999-8371021 CATTTTCTAAGTAAATGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133707709 Original CRISPR GCATAGCCAAGGCCATTGGA AGG (reversed) Intergenic
No off target data available for this crispr