ID: 1133713752

View in Genome Browser
Species Human (GRCh38)
Location 16:8427365-8427387
Sequence ACGTGTTCACAGGTTTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133713752_1133713757 17 Left 1133713752 16:8427365-8427387 CCTGCAGAAACCTGTGAACACGT No data
Right 1133713757 16:8427405-8427427 GCTGCTGCCATTAGTAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133713752 Original CRISPR ACGTGTTCACAGGTTTCTGC AGG (reversed) Intergenic
No off target data available for this crispr