ID: 1133714436

View in Genome Browser
Species Human (GRCh38)
Location 16:8433351-8433373
Sequence TTGTGCCTGTGGAAGTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133714436_1133714444 10 Left 1133714436 16:8433351-8433373 CCGGGAGACTTCCACAGGCACAA No data
Right 1133714444 16:8433384-8433406 TTGGTCCATGGAGAAAGGGGTGG No data
1133714436_1133714446 17 Left 1133714436 16:8433351-8433373 CCGGGAGACTTCCACAGGCACAA No data
Right 1133714446 16:8433391-8433413 ATGGAGAAAGGGGTGGTGATTGG No data
1133714436_1133714441 6 Left 1133714436 16:8433351-8433373 CCGGGAGACTTCCACAGGCACAA No data
Right 1133714441 16:8433380-8433402 CTCCTTGGTCCATGGAGAAAGGG No data
1133714436_1133714439 -2 Left 1133714436 16:8433351-8433373 CCGGGAGACTTCCACAGGCACAA No data
Right 1133714439 16:8433372-8433394 AATTTCAACTCCTTGGTCCATGG No data
1133714436_1133714438 -9 Left 1133714436 16:8433351-8433373 CCGGGAGACTTCCACAGGCACAA No data
Right 1133714438 16:8433365-8433387 CAGGCACAATTTCAACTCCTTGG No data
1133714436_1133714440 5 Left 1133714436 16:8433351-8433373 CCGGGAGACTTCCACAGGCACAA No data
Right 1133714440 16:8433379-8433401 ACTCCTTGGTCCATGGAGAAAGG No data
1133714436_1133714442 7 Left 1133714436 16:8433351-8433373 CCGGGAGACTTCCACAGGCACAA No data
Right 1133714442 16:8433381-8433403 TCCTTGGTCCATGGAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133714436 Original CRISPR TTGTGCCTGTGGAAGTCTCC CGG (reversed) Intergenic
No off target data available for this crispr