ID: 1133716274

View in Genome Browser
Species Human (GRCh38)
Location 16:8452349-8452371
Sequence CTCTCCATCCAGCTGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133716274_1133716277 5 Left 1133716274 16:8452349-8452371 CCTTACACCAGCTGGATGGAGAG No data
Right 1133716277 16:8452377-8452399 GTAGACACTAGAGAATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133716274 Original CRISPR CTCTCCATCCAGCTGGTGTA AGG (reversed) Intergenic
No off target data available for this crispr