ID: 1133718870

View in Genome Browser
Species Human (GRCh38)
Location 16:8475385-8475407
Sequence CACACAGGGAGTTGGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133718870_1133718876 -7 Left 1133718870 16:8475385-8475407 CCTGTTCCCCAACTCCCTGTGTG No data
Right 1133718876 16:8475401-8475423 CTGTGTGCATAATATCTGCATGG No data
1133718870_1133718877 7 Left 1133718870 16:8475385-8475407 CCTGTTCCCCAACTCCCTGTGTG No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133718870 Original CRISPR CACACAGGGAGTTGGGGAAC AGG (reversed) Intergenic
No off target data available for this crispr