ID: 1133718871

View in Genome Browser
Species Human (GRCh38)
Location 16:8475391-8475413
Sequence ATTATGCACACAGGGAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133718871_1133718877 1 Left 1133718871 16:8475391-8475413 CCCCAACTCCCTGTGTGCATAAT No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133718871 Original CRISPR ATTATGCACACAGGGAGTTG GGG (reversed) Intergenic
No off target data available for this crispr