ID: 1133718877

View in Genome Browser
Species Human (GRCh38)
Location 16:8475415-8475437
Sequence TCTGCATGGTGAAAATTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133718874_1133718877 -7 Left 1133718874 16:8475399-8475421 CCCTGTGTGCATAATATCTGCAT No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data
1133718873_1133718877 -1 Left 1133718873 16:8475393-8475415 CCAACTCCCTGTGTGCATAATAT No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data
1133718872_1133718877 0 Left 1133718872 16:8475392-8475414 CCCAACTCCCTGTGTGCATAATA No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data
1133718869_1133718877 8 Left 1133718869 16:8475384-8475406 CCCTGTTCCCCAACTCCCTGTGT No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data
1133718871_1133718877 1 Left 1133718871 16:8475391-8475413 CCCCAACTCCCTGTGTGCATAAT No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data
1133718870_1133718877 7 Left 1133718870 16:8475385-8475407 CCTGTTCCCCAACTCCCTGTGTG No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data
1133718875_1133718877 -8 Left 1133718875 16:8475400-8475422 CCTGTGTGCATAATATCTGCATG No data
Right 1133718877 16:8475415-8475437 TCTGCATGGTGAAAATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133718877 Original CRISPR TCTGCATGGTGAAAATTACT AGG Intergenic
No off target data available for this crispr