ID: 1133721447

View in Genome Browser
Species Human (GRCh38)
Location 16:8498239-8498261
Sequence CATGATCTGCAGAAGCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133721447_1133721450 12 Left 1133721447 16:8498239-8498261 CCGCTCTGCTTCTGCAGATCATG No data
Right 1133721450 16:8498274-8498296 TGCTGCTCATAAACCCACAGAGG No data
1133721447_1133721453 27 Left 1133721447 16:8498239-8498261 CCGCTCTGCTTCTGCAGATCATG No data
Right 1133721453 16:8498289-8498311 CACAGAGGCAGACTTTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133721447 Original CRISPR CATGATCTGCAGAAGCAGAG CGG (reversed) Intergenic
No off target data available for this crispr