ID: 1133722627

View in Genome Browser
Species Human (GRCh38)
Location 16:8509014-8509036
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133722619_1133722627 21 Left 1133722619 16:8508970-8508992 CCAATCATAATGGCTATTACTAA No data
Right 1133722627 16:8509014-8509036 CGGTGGGGCTGCGGAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133722627 Original CRISPR CGGTGGGGCTGCGGAGAAAA GGG Intergenic
No off target data available for this crispr