ID: 1133724056

View in Genome Browser
Species Human (GRCh38)
Location 16:8521074-8521096
Sequence TGCTGGTGTCTGACAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133724056_1133724059 7 Left 1133724056 16:8521074-8521096 CCTTGGCCTGTCAGACACCAGCA No data
Right 1133724059 16:8521104-8521126 CTTAACTACCACACTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133724056 Original CRISPR TGCTGGTGTCTGACAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr