ID: 1133725739

View in Genome Browser
Species Human (GRCh38)
Location 16:8535855-8535877
Sequence CAGGATCGACCCAAAGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133725739_1133725742 4 Left 1133725739 16:8535855-8535877 CCCGGCTCTTTGGGTCGATCCTG No data
Right 1133725742 16:8535882-8535904 AGTGTCTTATTAAGTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133725739 Original CRISPR CAGGATCGACCCAAAGAGCC GGG (reversed) Intergenic
No off target data available for this crispr