ID: 1133727510

View in Genome Browser
Species Human (GRCh38)
Location 16:8551152-8551174
Sequence CTGGTAAAAACCAGAATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133727510_1133727514 4 Left 1133727510 16:8551152-8551174 CCTAGAATTCTGGTTTTTACCAG No data
Right 1133727514 16:8551179-8551201 AAGAACCAGGAACAAGACTCTGG No data
1133727510_1133727511 -9 Left 1133727510 16:8551152-8551174 CCTAGAATTCTGGTTTTTACCAG No data
Right 1133727511 16:8551166-8551188 TTTTACCAGAACCAAGAACCAGG No data
1133727510_1133727516 17 Left 1133727510 16:8551152-8551174 CCTAGAATTCTGGTTTTTACCAG No data
Right 1133727516 16:8551192-8551214 AAGACTCTGGCCAAAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133727510 Original CRISPR CTGGTAAAAACCAGAATTCT AGG (reversed) Intergenic
No off target data available for this crispr