ID: 1133736220

View in Genome Browser
Species Human (GRCh38)
Location 16:8617799-8617821
Sequence GTGTCTGTCCTGACGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133736216_1133736220 11 Left 1133736216 16:8617765-8617787 CCTTCTGGAGGCTCTGAGGGAGA 0: 22
1: 135
2: 388
3: 973
4: 1715
Right 1133736220 16:8617799-8617821 GTGTCTGTCCTGACGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133736220 Original CRISPR GTGTCTGTCCTGACGCATGG AGG Intergenic
No off target data available for this crispr