ID: 1133737039

View in Genome Browser
Species Human (GRCh38)
Location 16:8623769-8623791
Sequence CACAGCAACCACTTAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133737039 Original CRISPR CACAGCAACCACTTAAATGT AGG Intronic
902103400 1:14012756-14012778 CACTCCAACCAATTAAATGGTGG + Intergenic
902416856 1:16244937-16244959 CACAGCATCCACTGACATGCTGG + Intergenic
902936306 1:19767250-19767272 CACAGCCATCCTTTAAATGTAGG - Intronic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
903709445 1:25311888-25311910 CACAGCACCCTTTGAAATGTAGG - Intronic
903717671 1:25380530-25380552 CACAGCACCCTTTGAAATGTAGG + Intronic
903752151 1:25631055-25631077 CACAAGAATCACTTAAATGCGGG - Intronic
903795240 1:25923430-25923452 CACAGCAAGGACTCAAAAGTTGG - Intergenic
904891855 1:33785174-33785196 CACAGCACCCAGCAAAATGTTGG + Intronic
905543824 1:38781833-38781855 CACAGCAGCCACTTGAACTTTGG + Intergenic
908087383 1:60650610-60650632 GAGGGCATCCACTTAAATGTGGG + Intergenic
908416126 1:63915063-63915085 CACAACAACCATTTGAAGGTAGG + Intronic
912257503 1:108075772-108075794 CACACCAAGCACTCAAATCTTGG - Intergenic
913656999 1:120970718-120970740 CACAGGAATCACTTGAATTTAGG - Intergenic
914860773 1:151384074-151384096 CACAGCAAACACATAGATCTAGG + Intergenic
918802383 1:188987575-188987597 CAAAGCAACCACTTGAATTTTGG + Intergenic
919318107 1:196000305-196000327 CAAACCAACCACTTCAGTGTTGG - Intergenic
919673290 1:200357293-200357315 CATTGCAACCATTTAAATTTGGG - Intergenic
920637109 1:207714284-207714306 CAAAGCCACCACTCAAAGGTGGG + Intronic
921087996 1:211814518-211814540 CATGGAAAGCACTTAAATGTTGG - Intronic
921381434 1:214528836-214528858 CACAAGAATCACTTAAATCTGGG + Intronic
922338129 1:224634203-224634225 CACAGCATCCACTTGGATGAGGG + Intronic
1063944099 10:11160278-11160300 CTCAGCAACCACTTAACTCTAGG - Intronic
1066355951 10:34683884-34683906 CCCACAAAACACTTAAATGTTGG + Intronic
1071258202 10:83894119-83894141 CACAGCTACCATGTACATGTAGG - Intergenic
1071443371 10:85724057-85724079 CATAGCAATCACTTTAATGTAGG + Intronic
1073124775 10:101142279-101142301 CGCAGCAACCAAAGAAATGTGGG - Intergenic
1074616196 10:115070799-115070821 TACAGCCACCACTAAAATGCTGG + Intergenic
1079472101 11:20788529-20788551 CAAAGAATCCAATTAAATGTGGG - Intronic
1081268061 11:41051209-41051231 AAAAGCTAACACTTAAATGTTGG + Intronic
1084243587 11:67839855-67839877 CACAAGAATCACTTAAATCTGGG - Intergenic
1085693469 11:78684157-78684179 CACAGCACGCACTCAAATATTGG - Intronic
1087760813 11:102102769-102102791 CAGAGAAGCCAATTAAATGTTGG + Intergenic
1088741976 11:112774695-112774717 CTCAGCAACCAGGTAAATGCAGG + Intergenic
1089989143 11:122842216-122842238 CATAGCAAACACTTGAATGAAGG + Intronic
1090833076 11:130433052-130433074 CACAGCAAGCACTCAAAAGATGG - Intergenic
1092302875 12:7269044-7269066 CACAGCAACTTCTCAAATCTTGG + Intergenic
1093412480 12:18883143-18883165 CACAGAAACCCCCAAAATGTTGG - Intergenic
1097362134 12:58669928-58669950 CACAGGAATCACTTAAACTTGGG - Intronic
1098711771 12:73771825-73771847 CAAAGATACCACTTAAAGGTGGG + Intergenic
1099767014 12:86999464-86999486 CAGAGGAACCCCTCAAATGTGGG - Intergenic
1100899615 12:99223186-99223208 TACAGCTACCATTTAAATCTAGG + Intronic
1102397713 12:112601597-112601619 CACAGCAACTACATAAAGTTAGG + Intronic
1103375785 12:120454978-120455000 CACAAGAATCACTTGAATGTAGG - Intronic
1106647907 13:31656514-31656536 CACCTCAATCTCTTAAATGTGGG - Intergenic
1110057102 13:70986894-70986916 CAAAGGCACCACTTAAAGGTGGG - Intergenic
1110283054 13:73718311-73718333 CCCATCAACCACTTAAATATAGG + Intronic
1111310005 13:86472143-86472165 CAAAGCCACCACTCAAAGGTGGG + Intergenic
1111645055 13:91022191-91022213 CACAGTAATCACTTAGATGGTGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112732023 13:102374326-102374348 CACAGTACCCACAAAAATGTGGG + Intronic
1112829060 13:103426366-103426388 CAAACCAACTACTTAAAAGTTGG + Intergenic
1113251989 13:108463553-108463575 CATAGTAACCTCTTACATGTTGG + Intergenic
1115049009 14:29033278-29033300 CACAGCATCCACTGAAGTGAAGG + Intergenic
1116891377 14:50272046-50272068 CACAACAATCACTTGAATCTGGG + Intronic
1116917037 14:50535509-50535531 AACAGAAATCAATTAAATGTTGG + Intronic
1122445548 14:101765195-101765217 CACTGAAAACACTGAAATGTTGG + Intronic
1122454624 14:101840693-101840715 AATAGGAACTACTTAAATGTTGG - Intronic
1123988273 15:25664272-25664294 CACAAGAATCACTTGAATGTGGG - Intergenic
1125453940 15:39838165-39838187 TAAAGCAACAATTTAAATGTAGG + Intronic
1131107428 15:89744511-89744533 TACACCAACCACAGAAATGTTGG - Intergenic
1132172568 15:99676242-99676264 AACAGAAAACAATTAAATGTGGG + Intronic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1133898013 16:9947816-9947838 CACAACAACCTCTTTAAGGTAGG - Intronic
1135539953 16:23322196-23322218 CACTGTAGGCACTTAAATGTGGG - Intronic
1135613015 16:23885040-23885062 CACAATAACTACTTAAAAGTAGG - Intronic
1137889671 16:52145951-52145973 TACAGCACCCACTATAATGTTGG + Intergenic
1138993420 16:62419357-62419379 TAAAGCAACAACTTAAATGCTGG - Intergenic
1139291701 16:65864337-65864359 CAAAGGCACCACTCAAATGTGGG - Intergenic
1144365976 17:14545356-14545378 CACAGCAAACACACAAATGGAGG - Intergenic
1144487995 17:15683660-15683682 CACAACCACCACTTAATAGTAGG + Intronic
1144913025 17:18698629-18698651 CACAACCACCACTTAAAAGTAGG - Exonic
1152792081 17:82286121-82286143 CACAACAACCACGTATATGATGG + Intergenic
1153291070 18:3501971-3501993 CACAGTAATTACATAAATGTTGG - Intronic
1154263558 18:12859690-12859712 CACAGCATCTACCTAAATTTTGG + Intronic
1155835930 18:30583968-30583990 CTCAGCAACTTTTTAAATGTAGG + Intergenic
1156951846 18:42910319-42910341 AACACCACCCACTTATATGTGGG + Intronic
1158998014 18:62943335-62943357 TTCAGCAACCATTTAAGTGTGGG - Intronic
1160432350 18:78820276-78820298 CACTGGGACCACTTACATGTGGG + Intergenic
1160945326 19:1640056-1640078 CAAAGAAACCACCTAAAAGTTGG + Intronic
1163467900 19:17479734-17479756 CACAAGAATCACTTGAATGTGGG - Intronic
1167850843 19:52200497-52200519 CACAACAAGCATTTACATGTTGG - Intronic
1168042083 19:53766621-53766643 CAAAGCAAGCACTTAAGTGTGGG + Intergenic
925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG + Intronic
930383816 2:50666080-50666102 GACAGAAAACACATAAATGTTGG - Intronic
931352236 2:61501779-61501801 CACTGCAGCCACATAAATGATGG + Intronic
932306468 2:70707078-70707100 CACAGGAACTACTGAAACGTGGG + Intronic
933452604 2:82475854-82475876 CTAATCAACTACTTAAATGTGGG - Intergenic
936727421 2:115337162-115337184 CACAGCATTCACTAAAATGTAGG - Intronic
936956270 2:118025662-118025684 CACAGAAATAACTTAAATGATGG - Intergenic
938961646 2:136349165-136349187 CACAAGAATCACTTGAATGTGGG - Intergenic
940757085 2:157695696-157695718 CACAGCATACAATTAAATGATGG - Intergenic
941021530 2:160411764-160411786 CAGTGCAACCATTTAAATCTAGG - Intronic
942161026 2:173187247-173187269 CACAGTAACCACTGAAAGGAGGG - Intronic
942421891 2:175816211-175816233 CACAGTAATGACTTAAATGATGG - Intergenic
942714623 2:178877792-178877814 CCAAGCAAGCATTTAAATGTTGG + Intronic
943591406 2:189802112-189802134 CACTGTAACCATTTAAATGGTGG - Intronic
945369773 2:209002996-209003018 CAAAGAAACCACTCAAAGGTGGG - Intergenic
945775643 2:214103291-214103313 CCCATCACCCACTGAAATGTTGG - Intronic
948512597 2:238479555-238479577 CACAGGAACCACTTGAACCTAGG - Intergenic
1169956977 20:11114471-11114493 CTGAGCAGCCAATTAAATGTAGG - Intergenic
1172937674 20:38632054-38632076 CACAACAATCACTTGAACGTCGG - Intronic
1173197266 20:40926045-40926067 CACAGCCATCAATCAAATGTAGG + Intergenic
1174177104 20:48652051-48652073 CACAGTTACTACTTAAATTTTGG - Intronic
1179646664 21:42780240-42780262 CATGGCAACCACTTCAATTTTGG + Intergenic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1184167257 22:42737169-42737191 CAAAGCAACCACTTCAAATTTGG - Intergenic
1184579022 22:45400173-45400195 CACACCTACCACCTAGATGTTGG + Intronic
949691505 3:6645158-6645180 CACACAAATCACTTACATGTAGG + Intergenic
953272569 3:41459766-41459788 CACAGCATCCACTTACAAGATGG + Intronic
955168645 3:56540991-56541013 TCCATCAACCCCTTAAATGTTGG + Intergenic
956979661 3:74621088-74621110 CACATCAACCTCCTAAGTGTTGG - Intergenic
959232741 3:103676809-103676831 CACAGTAATCACATAAATTTAGG - Intergenic
960588011 3:119338402-119338424 CACATCTACCAATTAAATGCAGG - Intronic
960846833 3:122011746-122011768 CACAGCAACAACTGAGATATGGG - Intronic
963674168 3:148287314-148287336 AACATCAAGCCCTTAAATGTTGG - Intergenic
965072564 3:163934337-163934359 CTCAGCAACTAACTAAATGTAGG - Intergenic
965605077 3:170490450-170490472 CACAACAACCATATAAATTTGGG + Intronic
966913829 3:184574158-184574180 CACAGCCACCAGCTAAGTGTTGG + Intronic
967468736 3:189838203-189838225 CACAGCAACAACAAAAAGGTAGG - Intronic
970183598 4:13425523-13425545 CCCAGCCACAACTTTAATGTAGG - Intronic
970869208 4:20795303-20795325 CTCAGCAACCACTTATATTTTGG + Intronic
971543409 4:27851803-27851825 CACAGCAAGGACATAAATCTAGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
973847115 4:54924124-54924146 GACAGCAACCACCCAAATCTAGG - Intergenic
976985658 4:91293338-91293360 TACAGCAACCACTTAATTGAGGG + Intronic
978289723 4:107123526-107123548 CCCAGCAACAATTAAAATGTCGG - Intronic
979013512 4:115401087-115401109 CAAAGCAACCACTTCAATTTTGG + Intergenic
980197955 4:129615789-129615811 CCAAGCATCCACTTAAAAGTTGG - Intergenic
980775128 4:137427278-137427300 GACAGTAACCACTTCTATGTAGG + Intergenic
983445140 4:167841026-167841048 CACAGCTAGGACTTAAATCTGGG - Intergenic
983706620 4:170667970-170667992 CAAATGAACCACTTCAATGTAGG - Intergenic
984796569 4:183665716-183665738 CACAGCAGCCACTTGAGTCTGGG - Intronic
986836237 5:11641015-11641037 CACAGTAAACACTGACATGTTGG - Intronic
986895901 5:12367968-12367990 CACAGGAACAACTCAAAGGTGGG + Intergenic
987397005 5:17433538-17433560 AACAGCCACCAATAAAATGTGGG - Intergenic
987577533 5:19750623-19750645 CTCAGTAACCAGTTAAATGTAGG + Intronic
989273896 5:39564823-39564845 CACAGCATCCATATAAAGGTAGG + Intergenic
991192541 5:63892061-63892083 CACAGTAAGCACTCAAATGTTGG - Intergenic
993570940 5:89538165-89538187 CACAACAATCATTTAAAAGTTGG - Intergenic
995516332 5:112957813-112957835 CACTGCAAGCTCTGAAATGTAGG - Intergenic
996811417 5:127519752-127519774 CTTAGCAACCACATAAATGTGGG - Intronic
998519722 5:142788840-142788862 CACAGAAAACACTTAAATGGTGG - Intronic
1000761599 5:165232261-165232283 AACAGCTCCCACTCAAATGTGGG + Intergenic
1000824205 5:166023963-166023985 CACAGCCACCACTTAAGTTTAGG - Intergenic
1003658753 6:8040761-8040783 CACAAGAACCACTTGAATCTGGG + Intronic
1004796766 6:19095101-19095123 CACAGGAGCCCCTTAAATCTGGG - Intergenic
1007020805 6:38519122-38519144 CACAGCATCCTCTTGCATGTGGG + Intronic
1011453184 6:87517410-87517432 CACAGCAAAAACTTAAATCATGG + Intronic
1012747166 6:103106180-103106202 CAAAGCAACCACTAAAATAGTGG + Intergenic
1013664698 6:112335500-112335522 CACAGCAGCCTCCTAAATGGTGG - Intergenic
1014439727 6:121460547-121460569 CACTGTCACCATTTAAATGTAGG - Intergenic
1016112702 6:140245361-140245383 CACAGCTACCATTTAAATCCAGG - Intergenic
1016323011 6:142868386-142868408 AAGAGCAATCACTTAAATCTCGG + Intronic
1016840802 6:148523170-148523192 CACAGCATCTACTGCAATGTTGG - Intronic
1018277670 6:162150234-162150256 CACAGCAATAACTTAAGTGTGGG + Intronic
1018441253 6:163815373-163815395 CACCCCTTCCACTTAAATGTTGG - Intergenic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1022806279 7:33825628-33825650 TACAATAACCACTTTAATGTGGG + Intergenic
1026333234 7:69371625-69371647 TATAGCAAGCACTCAAATGTTGG - Intergenic
1029103308 7:98152617-98152639 CACAGCAAACAGTCAATTGTGGG + Intronic
1030427567 7:109398509-109398531 CAAAGCAACCACTGGAATGTGGG - Intergenic
1035756844 8:2040748-2040770 CACAGCAGCCACCAAAGTGTGGG - Intergenic
1035835205 8:2743013-2743035 CACTGCAGCCACTATAATGTTGG - Intergenic
1038702657 8:29863537-29863559 CACAGGAATCACTTGAATCTGGG + Intergenic
1039234064 8:35482617-35482639 CAAAGTAAATACTTAAATGTTGG - Intronic
1039334070 8:36570704-36570726 CACAGCCAGCACTTACATTTTGG + Intergenic
1039879596 8:41616386-41616408 CACAAGAATCACCTAAATGTGGG - Intronic
1047925605 8:129679597-129679619 CGCAGCAACCACTTCAGTCTTGG - Intergenic
1048398888 8:134044442-134044464 GACAGCCACCACTTAAATGCAGG + Intergenic
1048856816 8:138693501-138693523 CCCACCAACCACTCAAGTGTGGG + Intronic
1049266995 8:141673305-141673327 CATAGCAATCGCTTAAATGGTGG - Intergenic
1051060244 9:13037267-13037289 CACAACAACTACACAAATGTGGG - Intergenic
1052766468 9:32646471-32646493 CAGACCAACCACTAAAATTTTGG + Intergenic
1057237714 9:93378443-93378465 CAAAGCAACCACATATATGGGGG - Intergenic
1057480184 9:95439206-95439228 CACAGCTTCCACTTACATGGCGG - Intergenic
1059923724 9:119186060-119186082 CACAGCAACAAATGAAATGGGGG - Intronic
1060082038 9:120657869-120657891 CACAGCAACTCCTTATATATAGG - Intronic
1060729478 9:126028089-126028111 AAAAGCAACCACCTAGATGTAGG + Intergenic
1061615431 9:131775853-131775875 AACACCCACCACTTACATGTTGG + Intergenic
1188023405 X:25183649-25183671 CACAGCTAGCACTTCAATGTGGG - Intergenic
1189155569 X:38753172-38753194 CAAAGCTACCGTTTAAATGTAGG - Intergenic
1189395356 X:40617735-40617757 CACAGGAACCATTTAAATCTGGG - Intergenic
1189706242 X:43761623-43761645 CACAGCAGCCACTCAGATTTGGG + Intergenic
1191136856 X:57073826-57073848 CACATAAAACAGTTAAATGTAGG + Intergenic
1192953535 X:76043966-76043988 CACAGCAAGCACTTCAATTCTGG - Intergenic
1194237916 X:91407772-91407794 CACAACAAACACTTAAACCTGGG - Intergenic
1198189406 X:134287763-134287785 CACAGCAACCACTCCAAGTTTGG + Intergenic
1201603182 Y:15753426-15753448 CACAGAAATCACTTGAATGCAGG + Intergenic