ID: 1133738552

View in Genome Browser
Species Human (GRCh38)
Location 16:8633777-8633799
Sequence CCTTCTCTGCATGAGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133738552 Original CRISPR CCTTCTCTGCATGAGGCACT GGG (reversed) Intronic
900710969 1:4113641-4113663 CTTTCTCTGCATCATGCTCTTGG + Intergenic
901391595 1:8949610-8949632 CCCTCTCTGGAAGAGCCACTAGG - Intronic
905225625 1:36477221-36477243 CCTACTCTGTACTAGGCACTGGG - Intronic
905441740 1:38000395-38000417 CCTTCTCTCCCAGAGGCAGTAGG - Intronic
906741469 1:48189352-48189374 GTTTTCCTGCATGAGGCACTGGG + Intergenic
907567246 1:55446860-55446882 CCTGCTATGCACCAGGCACTAGG + Intergenic
907701892 1:56796899-56796921 CCTACTATGCACTAGGCACTAGG + Intronic
907889306 1:58622443-58622465 CCTACTATGGATCAGGCACTTGG - Intergenic
909495919 1:76278591-76278613 CATTCTCTGCATCAGGGATTTGG - Intronic
910108743 1:83659390-83659412 CCTTCTAAGCAGAAGGCACTGGG + Intergenic
910466379 1:87504737-87504759 CCTACCCTGCACCAGGCACTAGG - Intergenic
910849227 1:91634974-91634996 CCTTCTCAGCAGGAAGAACTTGG + Intergenic
913649622 1:120899836-120899858 CTTTCTTTGTATGAAGCACTGGG + Intergenic
914077064 1:144363693-144363715 CTTTCTTTGTATGAAGCACTGGG - Intergenic
914102114 1:144602812-144602834 CTTTCTTTGTATGAAGCACTGGG + Intergenic
914171514 1:145229260-145229282 CTTTCTTTGTATGAAGCACTGGG - Intergenic
914296787 1:146334386-146334408 CTTTCTTTGTATGAAGCACTGGG - Intergenic
914449010 1:147774056-147774078 CCTTCTACGCATCAGGCACTGGG + Intergenic
914526623 1:148473228-148473250 CTTTCTTTGTATGAAGCACTGGG - Intergenic
914639779 1:149593895-149593917 CTTTCTTTGTATGAAGCACTGGG + Intergenic
916351939 1:163860446-163860468 CCTTCTGAGCATGAGGAACTAGG + Intergenic
916918338 1:169435637-169435659 CTTTGTATGCATCAGGCACTGGG - Intronic
917245094 1:172992177-172992199 CCTGCTCTTAATGAGGCACTGGG - Intergenic
918433433 1:184486159-184486181 CCTTCTCTGAGTCAGACACTGGG - Intronic
919755572 1:201064156-201064178 CCTCCTCTGCACCAGGCCCTGGG + Intronic
919771986 1:201167513-201167535 CGTTATCTGCAGGAGTCACTGGG + Intronic
919804065 1:201370294-201370316 CCTGCTCTGAATGAGGCTCTTGG + Intronic
921046719 1:211483004-211483026 ATTTCTCTGCATTAAGCACTGGG - Intronic
921563060 1:216681482-216681504 CCCTTCCTGCATGAGACACTAGG + Intronic
922131491 1:222784114-222784136 CCTTCACTGGATGGGGCATTTGG - Intergenic
922470132 1:225871615-225871637 CCTACTATGCATCAGGCGCTGGG + Intronic
922542052 1:226427164-226427186 GCTTCTGTGCATGAGGGACCAGG - Intergenic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
1067124158 10:43501272-43501294 GTTTCTCTGCATGAGTCAGTGGG + Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1071523915 10:86347266-86347288 GCTTCTCTGCCACAGGCACTTGG - Intronic
1072282067 10:93875290-93875312 CCTCCTTTGCACAAGGCACTGGG + Intergenic
1072412076 10:95212097-95212119 CATTCTGGGCATGAGTCACTGGG - Intronic
1073119445 10:101112641-101112663 GCTTCTGTGCAGGAGGCACGTGG - Intronic
1075358534 10:121807101-121807123 CCTGCTCTGTGTGAGGTACTTGG - Intronic
1075389647 10:122083347-122083369 CTTTCTCTGTCTGAGGCTCTTGG - Exonic
1075920499 10:126208362-126208384 CCTCCTCTGCAAGAGTCAATAGG + Intronic
1076276049 10:129199750-129199772 CCTTCTCTGAAGGAGGGAGTGGG - Intergenic
1077187195 11:1240677-1240699 CCGTTTCTGCATGAGGGACTGGG - Intronic
1077241901 11:1515072-1515094 CCTTTTCTGAAGGGGGCACTGGG - Intergenic
1077294747 11:1820940-1820962 CCTTCCCTCCATGTGGCCCTGGG + Intergenic
1078282889 11:9920364-9920386 GCTTCTCTGTATCAGGAACTTGG - Intronic
1078423643 11:11232265-11232287 CCTACTATGCACCAGGCACTAGG + Intergenic
1078647671 11:13156978-13157000 CCTACTATGTATCAGGCACTAGG - Intergenic
1078891618 11:15563058-15563080 GCTTCTCTTCATGAGCCCCTAGG + Intergenic
1081864817 11:46353698-46353720 ACCTCTCACCATGAGGCACTGGG - Intronic
1082191389 11:49249616-49249638 CTTTCCCTCCATGAGCCACTTGG + Intergenic
1082963508 11:58941709-58941731 GCCTCTCTGCTTCAGGCACTTGG - Intronic
1083369397 11:62166348-62166370 CCTACTGTGTGTGAGGCACTGGG + Intergenic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1084035424 11:66506975-66506997 CAGGCTGTGCATGAGGCACTGGG - Intronic
1085625698 11:78070795-78070817 CTGTCTGTGCATGAGGCTCTTGG + Intronic
1086674741 11:89591410-89591432 CTTTCCCTCCATGAGCCACTTGG - Intergenic
1087902399 11:103656286-103656308 CCTACTCTGTACAAGGCACTGGG + Intergenic
1088687937 11:112300215-112300237 CCTTTGCTGCCTGTGGCACTAGG + Intergenic
1089362854 11:117902483-117902505 CCTTCTCTGCCTGGGGAACAGGG - Intronic
1091744230 12:2981080-2981102 CCCACTCTGCATCAGGCACTGGG - Intronic
1092198871 12:6567691-6567713 TCTTCTCTGTATGAGTTACTAGG - Intronic
1092533604 12:9365692-9365714 ACTTCTGTGCATGAAGCAGTAGG + Intergenic
1098346302 12:69507638-69507660 CCTTTTCTGGATGAGGTTCTTGG + Intronic
1101204881 12:102476620-102476642 CCTTCTGTGTATAGGGCACTGGG + Intronic
1101809217 12:108093189-108093211 GCTTCCCTGTATCAGGCACTGGG - Intergenic
1103182774 12:118928468-118928490 CCTTCTCTTCATGGGGTAATAGG + Intergenic
1103443961 12:120981868-120981890 CCTGCTGTGCATCAGCCACTGGG - Intronic
1104044080 12:125149509-125149531 CCTTTTCTGCTTGAGCCAGTTGG - Intergenic
1105727711 13:23182328-23182350 TCTTCTCAGCTTGAGGCACCAGG + Intronic
1105832035 13:24171216-24171238 CCATCTGAGCATGAGGCACTTGG + Intronic
1107265366 13:38546823-38546845 CCTTCTCAGCAGGAAGAACTAGG - Intergenic
1107409203 13:40142808-40142830 CTTTCTATGTATAAGGCACTGGG - Intergenic
1107892988 13:44930518-44930540 CCTCCTCAGCATGAGGCATCGGG + Intergenic
1108013791 13:46052300-46052322 CCGTCTTTGCTTGAGTCACTGGG - Intronic
1110432856 13:75445356-75445378 CCTTGTCTACATGACACACTGGG + Intronic
1113224472 13:108144326-108144348 CCTACCCTACAGGAGGCACTGGG - Intergenic
1114178860 14:20348122-20348144 CCTTGTCCTCATGAGGCACTGGG + Intronic
1114627211 14:24137374-24137396 CCTTGACTGGATCAGGCACTGGG - Exonic
1114649222 14:24273005-24273027 CCTTCTTTGCAGTAGGCACAGGG - Intergenic
1115805044 14:37041239-37041261 CCTTCTCTGTTAGAGGCACTTGG - Intronic
1117200332 14:53383489-53383511 TCTTGTTTGCATGAGGAACTCGG + Intergenic
1118849596 14:69573592-69573614 CCTTCTCTTCTTCAGGCACTGGG + Exonic
1119935634 14:78590017-78590039 CCTTCTTTGGATGAGACACTTGG - Intronic
1121007573 14:90500145-90500167 CTTTCTCTGCACCAGGCACTGGG - Intergenic
1122317685 14:100835569-100835591 CCTTCTCTGCCTCAGTCCCTGGG + Intergenic
1122402619 14:101476267-101476289 CCTTGGCACCATGAGGCACTGGG + Intergenic
1122483717 14:102064308-102064330 CCTTCTCTGGATCAGGCACCAGG + Intergenic
1124054032 15:26225087-26225109 CCTTCCTTGCATGAGGGACAGGG - Intergenic
1124189530 15:27562558-27562580 CCTACCCTACCTGAGGCACTAGG - Intergenic
1125541021 15:40470382-40470404 CCTTCTCCTCATGAGGCAGTGGG - Intergenic
1125891450 15:43270083-43270105 CCATCTCAGCATGTGGCAGTGGG - Intergenic
1126105619 15:45145124-45145146 CCTTACCTGCATGAGGCCATGGG + Intronic
1126870123 15:52978504-52978526 CCTTCTTTGCATGTGGAACCTGG + Intergenic
1128331674 15:66760280-66760302 ACTGCTCTGCATGGGGCACCAGG - Intronic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1128512371 15:68321357-68321379 CCTTCACTGCCAGAGGCTCTGGG - Intronic
1128512546 15:68322258-68322280 CATTCCCTGCCTGAGGCATTCGG - Intronic
1128921126 15:71611283-71611305 TCTTTTCTGCATCAGGCATTTGG + Intronic
1129387338 15:75203049-75203071 CCTTCCCTACCTGAGGCTCTGGG - Intronic
1132057090 15:98660476-98660498 CCTCCTATGCACCAGGCACTGGG - Intronic
1132829578 16:1920749-1920771 CCCTCCCTCCATCAGGCACTCGG + Intergenic
1133465477 16:6022966-6022988 CCTTTACTGCATGAGGGATTCGG + Intronic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1134607673 16:15583775-15583797 CCTTCTAGGCATGAGGCCCCAGG - Intronic
1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG + Intergenic
1137680211 16:50335976-50335998 TCTTCTCTGGATGAGACATTAGG - Intronic
1138124106 16:54424601-54424623 CCTTCTGTGCAGGTGGCTCTGGG + Intergenic
1138623334 16:58229895-58229917 CCTACTGTGCATAAGGCACTGGG + Intergenic
1139156749 16:64452607-64452629 CATACTCTGCATGATGCTCTTGG - Intergenic
1140261112 16:73380832-73380854 CCATCTCTACAAGAGGAACTTGG + Intergenic
1140886616 16:79249901-79249923 CCTGCTTTGCATCAGGCACTGGG - Intergenic
1141570656 16:84931706-84931728 CCCTCTCTGCCTGAGTCACAAGG - Intergenic
1141827905 16:86493874-86493896 ACTTCTCTGCACCCGGCACTGGG + Intergenic
1147340505 17:39750840-39750862 CCTTCACAGCCTGAGGCACTGGG + Intergenic
1148745338 17:49914856-49914878 CCTTCTAGGTATCAGGCACTGGG + Intergenic
1148884813 17:50764728-50764750 CCTGCTTTGCACCAGGCACTGGG + Intergenic
1149451972 17:56756875-56756897 TGGTCTCTGCATGAGGCATTTGG + Intergenic
1150212671 17:63450001-63450023 CCTTCTCTGTGCCAGGCACTAGG + Intergenic
1150611810 17:66739441-66739463 CCTGCTCTGCACCAGGCACTGGG + Intronic
1151404707 17:73878824-73878846 CCATCTTTGCATGTGGCATTTGG + Intergenic
1151777026 17:76211778-76211800 CCTTCTCTGCATCATGCAGGAGG - Intronic
1152631790 17:81413810-81413832 CCTTCTCTGGATGGGGCGCAGGG + Intronic
1153532014 18:6056410-6056432 CCTGCTAGGCAGGAGGCACTGGG + Intronic
1153627702 18:7037675-7037697 CCGTCTCAGCAAGATGCACTAGG - Exonic
1153773465 18:8433478-8433500 ACCTCTTTGCAGGAGGCACTTGG - Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157140758 18:45103728-45103750 CCTTCTCTACCTGTGGGACTTGG + Intergenic
1160014524 18:75129853-75129875 GCTCCTCTGCATGCGGCACCAGG - Intergenic
1160015124 18:75134260-75134282 CTTTCTCCGCAGGAGGCCCTGGG - Intergenic
1160507686 18:79436629-79436651 CCTTCTCTCCAGGAAGCATTCGG + Intronic
1160865249 19:1253295-1253317 CCTTCTCTGCTTGGGGCCCATGG - Intronic
1161720089 19:5897702-5897724 GCTTCTATGCATGAGGAGCTTGG + Intronic
1162456812 19:10790086-10790108 CCATGTCTGCATGAGGACCTTGG - Intronic
1163266790 19:16226807-16226829 CCTGCTCTGCCTGGGGCACTGGG + Intronic
1163354902 19:16803980-16804002 CATTTTCTGCATGAGGTAGTTGG + Intronic
1164582238 19:29441839-29441861 CCTTCTCTGCATGAGGGTTGGGG - Intergenic
1165689509 19:37852485-37852507 CCTTCTTTGCAGGGGCCACTTGG - Intergenic
1166844651 19:45719336-45719358 ACTTCTCTACATGAGTCCCTAGG + Intronic
1167034116 19:46983387-46983409 CTTACTCTGTATGAGGCACACGG - Intronic
1168270223 19:55245750-55245772 TCTTCTCTGCACCGGGCACTGGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925687647 2:6489985-6490007 CCTTCCCAGAATGAGGAACTAGG + Intergenic
926220357 2:10932069-10932091 CCTTCTGTGCATGTGGCTCTTGG + Intergenic
935492748 2:103740736-103740758 CCTGCTCTGCATCAAGCACAAGG + Intergenic
937651881 2:124328324-124328346 GCTTCCATGCATGAGGCAGTGGG + Intronic
940106920 2:150111487-150111509 CCTTCTCTGAATGATGGAGTGGG - Intergenic
940132875 2:150404235-150404257 TCTTCTCTGCATGATTCCCTAGG + Intergenic
940672511 2:156688014-156688036 CTTTCTCTGCATGGAGCACTAGG + Intergenic
943198057 2:184781033-184781055 GCTTCTCTGCATGAGAATCTTGG + Intronic
943494074 2:188597162-188597184 CATTTTCTGCATGAGACACAGGG - Intergenic
945596395 2:211800131-211800153 CCAACTATGCATGAGGCATTTGG - Intronic
946176425 2:217924623-217924645 CCTACTATGCACCAGGCACTGGG + Intronic
946420527 2:219562152-219562174 CTTTCCCTGAATCAGGCACTGGG - Intronic
946726766 2:222669415-222669437 CTTTCTATGTATTAGGCACTGGG - Intergenic
946864072 2:224027147-224027169 ACTTCTCTGCATGAAGGGCTTGG + Intronic
947520507 2:230842416-230842438 CCTTCTCTTCATGAATGACTGGG - Intergenic
949075611 2:242055632-242055654 CCTTCTCTCCATGGCGCCCTGGG + Intergenic
1170758934 20:19231990-19232012 TCTCCTCCACATGAGGCACTGGG - Intronic
1171284387 20:23925137-23925159 CCTTCTCTGCATCATGCATCTGG + Intergenic
1172044635 20:32071605-32071627 ACTTCCCCGCATGAGGCTCTTGG + Intronic
1172055166 20:32149813-32149835 CCTTCTCTCCTTGAGGCACCTGG - Intronic
1173925581 20:46778783-46778805 CCTCCTCTGCACCAGGCATTGGG + Intergenic
1174172928 20:48628232-48628254 CCTCCTCTGAGCGAGGCACTGGG - Intronic
1174272307 20:49378528-49378550 TCTACTCTGCGTGAGGCACTAGG + Intronic
1174396678 20:50251041-50251063 CCTTTTCTGCATGGGGCCCGGGG + Intergenic
1174988759 20:55486205-55486227 CCTTCTCTGTGCTAGGCACTTGG - Intergenic
1175041760 20:56058778-56058800 CCTTGTGTGCATGAAGCATTTGG - Intergenic
1176061450 20:63174597-63174619 CCATCCCTGGGTGAGGCACTGGG + Intergenic
1178976032 21:37221612-37221634 TCTACTCTGCATGAAGCCCTGGG + Intergenic
1179345712 21:40554970-40554992 CCTTCTGTGCACTAGGTACTGGG - Intronic
1179571605 21:42281906-42281928 CCTTCTCCGTATGGGGCACTGGG + Intronic
1181601577 22:23955366-23955388 CCCTCTCCCCATCAGGCACTGGG - Intergenic
1181606923 22:23985932-23985954 CCCTCTCCCCATCAGGCACTGGG + Intergenic
1181784564 22:25217641-25217663 CCTACTATGCGTCAGGCACTGGG + Intergenic
1182172540 22:28247432-28247454 CCTACGCTGCTTGAGGCACTGGG + Intronic
1182713941 22:32340317-32340339 CCTTCTGTGCACAAGGCACTGGG + Intergenic
1182859799 22:33549197-33549219 TCTTCTCTGCACCATGCACTGGG - Intronic
1183516671 22:38270840-38270862 CCTTCTCAGGGTGAGGGACTGGG + Intronic
1184401253 22:44275901-44275923 CCTTCTGTGCACAAGGCACGGGG + Intronic
1184458971 22:44626410-44626432 CCTTCTCTTCATCAACCACTAGG - Intergenic
949619507 3:5794600-5794622 TCTTCTATGCATGAGACACTGGG - Intergenic
950216769 3:11165680-11165702 CTTTCTCTGCATTGGTCACTAGG + Intronic
950565883 3:13769374-13769396 CCTTCTCTGAAAGGGGCTCTCGG - Intergenic
950725129 3:14912271-14912293 CAGGCTCTGCATGAGGCACTAGG + Intronic
951838662 3:27009640-27009662 ACTTCTCTCTATGAGGAACTGGG - Intergenic
952395075 3:32914067-32914089 CCTTCTTTGCATGAGGGACGTGG - Intergenic
953734201 3:45477412-45477434 CCTTCAGTGCCTGAAGCACTTGG + Intronic
954131958 3:48565413-48565435 CCTCCTCTGCATGAGAGACGCGG + Exonic
954535210 3:51354757-51354779 CCTTCTCTGTATCAGGCCCTGGG - Intronic
955113941 3:55978057-55978079 TCTGCTCTGTATCAGGCACTGGG - Intronic
956545426 3:70395830-70395852 CAATCTCTTCATGAAGCACTTGG - Intergenic
956595572 3:70963184-70963206 TCCACTCTGCATGAGGCACTGGG - Intronic
958892578 3:99796814-99796836 CCTTCTCTGTACCAAGCACTGGG + Exonic
961319895 3:126065166-126065188 CATTCTCTTCATGAGGCTCTGGG - Intronic
962259255 3:133892715-133892737 TCTTCTGTGCATGGGGGACTTGG - Intronic
962457431 3:135577573-135577595 CATTCTCTCTGTGAGGCACTTGG + Intergenic
965912594 3:173797823-173797845 ACTTCTTTGCATGTGGCACATGG - Intronic
967742639 3:193020228-193020250 CCTTCTCTCCATGAGAAGCTGGG - Intergenic
969710598 4:8840909-8840931 CCCTCTCTCCAGGAAGCACTGGG - Intergenic
969875206 4:10131227-10131249 CCTTCTCTGCACCAGGCTCCGGG - Intergenic
970807903 4:20057280-20057302 CTCTCTCTGCATGAGACACAGGG - Intergenic
971208630 4:24594328-24594350 CTTTCTCTGCCTGAGCCACGGGG - Intergenic
972558689 4:40206145-40206167 CATTCTCTGCATGGGCAACTAGG - Intronic
972686731 4:41360086-41360108 CCTACTATGCGTCAGGCACTGGG - Intronic
972982552 4:44723895-44723917 CCTTATCTGCATGAAGGATTTGG + Intronic
976212802 4:82688674-82688696 CCTTGCCTTCATGTGGCACTTGG + Intronic
977848348 4:101792545-101792567 TCTTCTCTAAATGAGGCAGTTGG - Intronic
982091892 4:151887233-151887255 CCTTCTCTGCATCTGGCAGCTGG - Intergenic
982330845 4:154180483-154180505 TCTTCTCTGCAGGTGGCCCTGGG + Intergenic
983491163 4:168391137-168391159 CTTTCTCTGTGTGTGGCACTTGG - Intronic
985154923 4:186977484-186977506 TATTCTATGCATTAGGCACTAGG - Intergenic
985585649 5:732437-732459 CCCTCACTGCATGTGGCACACGG - Intronic
985600083 5:823863-823885 CCCTCACTGCATGTGGCACACGG - Intronic
988499340 5:31771366-31771388 CCTACTATGCATGGGGCACTGGG + Intronic
989350359 5:40479104-40479126 ACTCCTCAGCATCAGGCACTTGG + Intergenic
989980894 5:50643077-50643099 CTTTCTTTGTATGAAGCACTGGG + Intergenic
989997693 5:50855340-50855362 CCTTGTCTGTATCAGGCCCTGGG - Intergenic
990619111 5:57540766-57540788 CCAACTCTGCATGAGGCCCTTGG - Intergenic
991012800 5:61901388-61901410 CCTTCTCTGCATCAGGGAAATGG + Intergenic
992147082 5:73861166-73861188 CCAGCTCTGCATGAGTGACTCGG - Intronic
997599087 5:135127280-135127302 CCTTCCCTGCAGGCAGCACTCGG - Intronic
997718655 5:136060972-136060994 CCTTTTCTTCATGTGGCAGTTGG + Intronic
997725794 5:136118910-136118932 CCTTCTCTGCATGGGGAAGGGGG - Intergenic
997748930 5:136326044-136326066 CCTTATCTGCATGAAGGATTTGG - Intronic
998559300 5:143156322-143156344 CCTTCTCTGCATTAGGGATCTGG + Intronic
999899788 5:156074215-156074237 CCTTCTGTGCATACTGCACTGGG - Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1002724834 5:181287770-181287792 GCTTTTCTGCATGCAGCACTGGG + Intergenic
1003068311 6:2921650-2921672 CCTTCTCAGCATGAAGCAGCCGG - Intergenic
1003463580 6:6355147-6355169 CCTTCTCTGAATGAGCCTCATGG + Intergenic
1003515798 6:6817764-6817786 TCTTCTCTGCATCAGGCCATAGG + Intergenic
1007059927 6:38928834-38928856 TCATCTCTGCATGAGCCAATTGG - Intronic
1007111617 6:39316210-39316232 CCATCTCTGCATGAGGCCCCCGG - Intronic
1007351844 6:41279200-41279222 CCTTATCTGGATGAAGCATTTGG - Intronic
1011720327 6:90149643-90149665 CCTTCTCTCCATCATGCACAGGG - Intronic
1012195019 6:96330737-96330759 CCTTCTCTGAAGGTGACACTGGG + Intergenic
1012526917 6:100188894-100188916 CCTACTCTGCTTTAGTCACTTGG + Intergenic
1017212328 6:151870752-151870774 CCTTCTGTGCACCATGCACTGGG - Intronic
1018131781 6:160738712-160738734 CCTTCTCTGGCTGTGACACTAGG + Intronic
1018340846 6:162849420-162849442 CTTTCTCAGCAGCAGGCACTGGG - Intronic
1018990027 6:168667514-168667536 CCTTCTCTGCCAGTGCCACTCGG - Exonic
1019183169 6:170205344-170205366 TGTTCTCAGCCTGAGGCACTCGG + Intergenic
1019565981 7:1679344-1679366 CCCTCCCTGCAGGAGGCTCTGGG + Intergenic
1024257505 7:47549657-47549679 CCTCTCCTGCATGAGGCCCTAGG + Intronic
1024293933 7:47827981-47828003 CATTCACTGGATCAGGCACTGGG + Intronic
1024929974 7:54659343-54659365 CTTTCACTGTGTGAGGCACTGGG - Intergenic
1025150380 7:56542357-56542379 CCCTCTCAGCATGAGACGCTTGG + Intergenic
1026663937 7:72325780-72325802 CGTTCCCTTCATGAGTCACTTGG - Intronic
1026772665 7:73212187-73212209 CCTTCTCAGCCTGTGGCATTTGG - Intergenic
1027013529 7:74765587-74765609 CCTTCTCAGCCTGTGGCATTTGG - Intergenic
1027074509 7:75180446-75180468 CCTTCTCAGCCTGTGGCATTTGG + Intergenic
1030679123 7:112415697-112415719 CCTTTTCTGCATGGCCCACTGGG - Intergenic
1031012612 7:116539364-116539386 CTGACTCTGCATGGGGCACTGGG - Intronic
1031486858 7:122337319-122337341 ACATCTTTGCATGAGGCACCTGG - Intronic
1031965539 7:128025648-128025670 CCTCCTCTGTAGCAGGCACTTGG - Intronic
1032003637 7:128282921-128282943 CCTGCTCTATATGAGACACTGGG - Intergenic
1032887906 7:136162218-136162240 CTTTCTCTGCATTAGGGATTGGG + Intergenic
1033032688 7:137843156-137843178 TCTTCTATGCAACAGGCACTGGG - Intronic
1034817316 7:154183684-154183706 CGTTCTCTCCATGAGGCTGTGGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1038333431 8:26627721-26627743 CCTTCTCTTCATGAGGTCTTGGG + Intronic
1042042607 8:64608984-64609006 CCTACTCTGCTTGGAGCACTGGG + Intronic
1042403106 8:68372388-68372410 TCTTCTCAGCAGGAGGGACTGGG - Intronic
1043107857 8:76137437-76137459 CCTGCTATGTATGAGGCACGGGG - Intergenic
1046584992 8:116140278-116140300 CCTTCTCTGAAGAATGCACTTGG - Intergenic
1047860797 8:128964641-128964663 CCTACTCTATATCAGGCACTGGG - Intergenic
1047923850 8:129663071-129663093 CAAACTCTGCATGAGACACTAGG - Intergenic
1048338749 8:133522905-133522927 CCTTCTCTGCCCTAGGCTCTAGG - Intronic
1049391227 8:142372710-142372732 CCTTCTCAGGAGGAGGCCCTTGG - Intronic
1049408030 8:142460354-142460376 CCTTTTCTGGATGGGCCACTGGG - Intronic
1049594967 8:143479087-143479109 GCTTCTCGGAATGAGGCTCTTGG - Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1052867027 9:33470122-33470144 CCTTCACGGCATAGGGCACTTGG + Exonic
1054817932 9:69493650-69493672 GGGTCTCTGTATGAGGCACTTGG - Intronic
1055729833 9:79268996-79269018 TGTTCCCTGCAAGAGGCACTAGG + Intergenic
1055915319 9:81394600-81394622 CTTTCTCTGGATGAGCCACTTGG - Intergenic
1057894715 9:98899847-98899869 CCTTCTCAGGGTCAGGCACTAGG + Intergenic
1058495235 9:105551838-105551860 CACTCTTTGCATGTGGCACTGGG - Intronic
1059172154 9:112135792-112135814 CCTTTTCTGCACTAGGCACAGGG + Intronic
1060263658 9:122096446-122096468 CTATTTCTGCCTGAGGCACTGGG - Intergenic
1060719795 9:125969288-125969310 CCTTTTCTGCATCAAGCAGTGGG + Intergenic
1060810171 9:126607305-126607327 CCTTCTCTGGATAAGGCAGCAGG - Intergenic
1060936202 9:127517601-127517623 CCTACCCTGGACGAGGCACTGGG - Intronic
1062410712 9:136422744-136422766 CCTTCTGTCCATGCGGCCCTCGG + Intronic
1192208029 X:69109054-69109076 CCATCTCTGGACAAGGCACTTGG + Intergenic
1195544662 X:106101069-106101091 CCCCCTCTGCAGGAGTCACTGGG + Intergenic
1198282427 X:135155183-135155205 CCTTCACGGCATGGGGCAGTTGG + Intergenic
1198288532 X:135217339-135217361 CCTTCACGGCATGGGGCAGTTGG - Intergenic