ID: 1133738731

View in Genome Browser
Species Human (GRCh38)
Location 16:8635253-8635275
Sequence GATGCTAGCGAGCCCCGTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133738731_1133738738 23 Left 1133738731 16:8635253-8635275 CCGGCACGGGGCTCGCTAGCATC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1133738738 16:8635299-8635321 CGTTTATTGTACAGGTAATGAGG 0: 1
1: 0
2: 0
3: 13
4: 96
1133738731_1133738736 15 Left 1133738731 16:8635253-8635275 CCGGCACGGGGCTCGCTAGCATC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1133738736 16:8635291-8635313 GCACGGACCGTTTATTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 7
1133738731_1133738733 -2 Left 1133738731 16:8635253-8635275 CCGGCACGGGGCTCGCTAGCATC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1133738733 16:8635274-8635296 TCATCGCAGCCACCATGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 144
1133738731_1133738732 -7 Left 1133738731 16:8635253-8635275 CCGGCACGGGGCTCGCTAGCATC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1133738732 16:8635269-8635291 TAGCATCATCGCAGCCACCATGG 0: 1
1: 0
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133738731 Original CRISPR GATGCTAGCGAGCCCCGTGC CGG (reversed) Exonic
901800955 1:11707752-11707774 GGAGCTAGCTAGCCCCCTGCTGG + Intronic
1066162210 10:32746219-32746241 GATGCTTGGCAGCCCTGTGCAGG - Intronic
1071489055 10:86123577-86123599 GCTGCTACCAAGCCCAGTGCAGG - Intronic
1077360799 11:2139445-2139467 GAGGCCAGCGAGGCCCGCGCGGG - Intronic
1089494954 11:118903151-118903173 GTTCCGAGGGAGCCCCGTGCAGG - Intronic
1089729534 11:120511718-120511740 GCTGCGAGCGAGCCCGGCGCGGG - Intergenic
1098578945 12:72076062-72076084 GATACCAGCTAGCCCCCTGCCGG - Intronic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1114181747 14:20373677-20373699 GCTGCCATGGAGCCCCGTGCAGG - Exonic
1119575352 14:75716075-75716097 GATGCAAAGGGGCCCCGTGCTGG - Intronic
1121558969 14:94860284-94860306 GGTGCTAGCTAGCCTAGTGCTGG + Intergenic
1124218550 15:27829650-27829672 GATGCTAGGGATCCCAGTACAGG - Intronic
1124443183 15:29704663-29704685 AGTGCTAGCTAGCCACGTGCAGG + Intronic
1128514242 15:68332236-68332258 GTTACTAGCGAGGCCAGTGCTGG - Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1131399703 15:92114482-92114504 GTTGCTAATGTGCCCCGTGCAGG - Intronic
1133738731 16:8635253-8635275 GATGCTAGCGAGCCCCGTGCCGG - Exonic
1138353272 16:56358003-56358025 GATGCCAGGAAGCCCCCTGCAGG + Intergenic
1151692137 17:75693220-75693242 GATGCTCCCGAGCCCCACGCCGG - Intronic
1166762653 19:45234596-45234618 GACGCTGGCGGGCCCCGGGCCGG - Intronic
935627862 2:105185842-105185864 GATGCTATCAAGCCCCCAGCTGG - Intergenic
944886929 2:204072614-204072636 GATGCGAGGGTGCCCCCTGCTGG - Intergenic
946305934 2:218857170-218857192 GATGCCAGCCAGCCCCTTGATGG + Intergenic
967922504 3:194623528-194623550 GCTGCTAGCGAGCCTGCTGCAGG - Exonic
969676557 4:8617644-8617666 GTTGCTGCTGAGCCCCGTGCAGG + Intronic
987861497 5:23492861-23492883 GATGCTTGGTAGCCCCATGCAGG + Intergenic
1000533625 5:162453964-162453986 GGTGCTAGCACACCCCGTGCAGG + Intergenic
1003171719 6:3725838-3725860 GATGCTCCCGAGCCCCATGGCGG + Intronic
1003171966 6:3727044-3727066 GATGCTGCCGACCCCAGTGCCGG + Intronic
1008045653 6:46849116-46849138 GAGGCTCGCGCGCCCCCTGCTGG - Intergenic
1019544191 7:1565275-1565297 GATGCTTGAGGGCCCCTTGCAGG - Intergenic
1026883526 7:73922242-73922264 GCTGCTGGCGAGCCCGATGCTGG + Intergenic
1029381349 7:100217266-100217288 CATGCCAGCAAGCCCCCTGCTGG + Intronic
1029400779 7:100344576-100344598 CATGCCAGCAAGCCCCCTGCTGG + Intronic
1035729227 8:1842733-1842755 GATGCCAGCGAGTCCCGGGAAGG - Intronic
1056843478 9:90017824-90017846 GATACTGGCGACCCCAGTGCTGG + Intergenic
1058001328 9:99869084-99869106 GATGCTGGCCATCCCCATGCTGG + Intergenic
1191643434 X:63452656-63452678 GTTGCTTGCCAGCCCTGTGCAGG - Intergenic