ID: 1133739985

View in Genome Browser
Species Human (GRCh38)
Location 16:8644110-8644132
Sequence GAGAACAGAGAGAAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 482}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133739985 Original CRISPR GAGAACAGAGAGAAAACTGC TGG (reversed) Intronic
900562730 1:3315519-3315541 AAGAACAAAGAGAAAGCCGCAGG - Intronic
900832708 1:4976777-4976799 GAGACCAAAGAGAAAACTGTTGG + Intergenic
901616414 1:10543469-10543491 GGGCACAGAGAGAAAAGAGCAGG + Intronic
904975759 1:34455069-34455091 GAGAGGAGAGAGAAAAGTGTGGG + Intergenic
905118912 1:35666708-35666730 GAGAACAGAGAGAAAAATGGAGG - Intergenic
907269408 1:53282057-53282079 GAGATCAGAGAGCAAAATGGAGG - Intronic
908122604 1:61000296-61000318 GAGAACAGAGAGAACAGAGAGGG - Intronic
908194291 1:61733903-61733925 GAGAACAAGGGGAAAACTGAAGG - Intergenic
908201857 1:61805783-61805805 GACAATAGACAGAAAACTGTTGG + Intronic
908294211 1:62697275-62697297 GAGAACTGAGTGAGACCTGCTGG + Intergenic
909175059 1:72346968-72346990 TAGAACAGTGAGAAAATTTCTGG - Intergenic
910996227 1:93106959-93106981 GAGAACAGAAGTAAAAATGCAGG - Intronic
911343527 1:96669307-96669329 AAAAAAAGAAAGAAAACTGCAGG - Intergenic
911515548 1:98864326-98864348 GAAATCCTAGAGAAAACTGCTGG - Intergenic
912533496 1:110343796-110343818 GATAACAGAAAGAAAACAGTTGG - Intronic
913049404 1:115103814-115103836 CAGGGCAGAGAGAATACTGCAGG + Intergenic
913398767 1:118404596-118404618 CAGAACAGAGAGAAAAATTTGGG + Intergenic
915074434 1:153297013-153297035 AGGAACAGAGAGAATGCTGCTGG + Intergenic
915243528 1:154540903-154540925 GGGAGCAGAGGGAATACTGCAGG + Intronic
915754600 1:158247876-158247898 GAGAAGAGAGAGAAAGGTGGAGG + Intergenic
916438717 1:164800977-164800999 GTGAACACAGAGAAAAATGCAGG - Intronic
916768210 1:167882503-167882525 AAGAACAGAGCGAAAACACCTGG + Intronic
916922935 1:169487551-169487573 GACTACAGAGAGAAAACAGGTGG + Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
916980676 1:170133311-170133333 TAGAAAACAGTGAAAACTGCTGG - Intergenic
917235058 1:172883135-172883157 GGGGAGAGAGTGAAAACTGCAGG + Intergenic
917356082 1:174127916-174127938 AAGAAAAGAAAGAAAACTTCAGG - Intergenic
917443977 1:175091251-175091273 GAGAACTGAGAGAAAAGGGAAGG + Intronic
917450454 1:175143631-175143653 GAGGGCAGAGAGAAATCTCCTGG + Intronic
917567628 1:176229510-176229532 GAGCACAGAGGGTATACTGCAGG + Intergenic
917611575 1:176693998-176694020 GAGAAAAGGAAGCAAACTGCAGG - Intronic
917741645 1:177967119-177967141 GAAAGCAGATAGAAACCTGCAGG - Intronic
918910976 1:190569261-190569283 CACAACAGAGATAAAACTGGAGG - Intergenic
919140906 1:193570672-193570694 GAGATCAGAGTGAAAACTTAGGG - Intergenic
919271852 1:195358812-195358834 AAGAAGAGAAAGAAAACTTCAGG + Intergenic
919518552 1:198557569-198557591 GAAAACAGAGATAAAAGTCCAGG - Intergenic
920823608 1:209403864-209403886 GAGGACAGACATAAAACTGTTGG + Intergenic
921276530 1:213526070-213526092 CAGTAGAGTGAGAAAACTGCAGG + Intergenic
921840829 1:219826596-219826618 GAGAAGATAGAGATAACTGTGGG - Intronic
922090582 1:222391631-222391653 GAGAACACCGAGCACACTGCAGG + Intergenic
923429969 1:233910493-233910515 CAGAATAGAGAGAGAAGTGCTGG + Intronic
923774173 1:236963587-236963609 GACAACATAGAGTGAACTGCTGG + Intergenic
924204635 1:241698982-241699004 GAGAAGAATGAGAAAACTGAGGG + Intronic
1064579346 10:16778371-16778393 AAGGGCAGAGAGGAAACTGCTGG - Intronic
1064684208 10:17842775-17842797 GAGTTCAGGGAGAAAACTTCCGG + Intronic
1065087807 10:22197495-22197517 AAGAAAGGAGAGAAAACAGCTGG - Intergenic
1065850371 10:29782607-29782629 GAGAACAGAGAGGAAGTGGCAGG + Intergenic
1066227064 10:33393718-33393740 GAGAGGAGACAGAAAGCTGCAGG + Intergenic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1067787060 10:49258090-49258112 GAGAACAGGGACAAACCTCCTGG + Intergenic
1068439748 10:57036609-57036631 GACAACATAGAGGAAACTGGAGG - Intergenic
1069128811 10:64672766-64672788 GAGGTCAGAATGAAAACTGCAGG - Intergenic
1070190917 10:74111446-74111468 CAGAACAAAGTGAACACTGCTGG - Intronic
1070278938 10:75034831-75034853 GAAAACAGAGAGAACACTCCCGG - Intergenic
1071238814 10:83680997-83681019 GAGAAAAGAGACAAAAATACAGG - Intergenic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1071515691 10:86295303-86295325 GAGAGGAGGGAGAGAACTGCTGG + Intronic
1073586701 10:104717378-104717400 GAGAACAGAAGGAAACCTGAAGG - Intronic
1075316716 10:121459102-121459124 GTGAGCAGAGAGACAACAGCAGG + Intergenic
1075329756 10:121565402-121565424 GAGAAGAGAGAGCATAGTGCTGG + Intronic
1075457252 10:122592847-122592869 GAGGCCGAAGAGAAAACTGCTGG + Intronic
1075792971 10:125098630-125098652 GTGAACAGAGAGAGAAATGGGGG + Intronic
1076507988 10:130990891-130990913 ATGAACAGAGAGAAATGTGCAGG + Intergenic
1076751310 10:132544820-132544842 GTGAGCAGAGAGAACACCGCCGG - Intronic
1076774444 10:132686869-132686891 GAGTTAAGAGAGAAAACTGCAGG - Intronic
1077277890 11:1725049-1725071 GAGAACAGAAGGATAACTACAGG + Intergenic
1077722601 11:4643470-4643492 GAGGACAGAAAGAACACTTCAGG + Exonic
1078024586 11:7682668-7682690 AGGAGCAAAGAGAAAACTGCTGG - Intergenic
1079009713 11:16817982-16818004 AAGAGCAGTGAGAAAACAGCAGG - Intronic
1079049632 11:17142625-17142647 GACAACACAGAGAAATCTGCAGG + Intronic
1079491162 11:20990524-20990546 GAGCATGGAGAGAAAAATGCTGG - Intronic
1079525427 11:21381745-21381767 GGGAACAGAGAGAATAGAGCTGG - Intronic
1079769930 11:24446077-24446099 GAGAAGAGAGAGAACAATGTGGG + Intergenic
1079941259 11:26683688-26683710 GAGAGGAGAGAGAAAACGGCTGG + Intronic
1080049606 11:27846078-27846100 GAGAACAGGGAGAGCAGTGCAGG - Intergenic
1080452257 11:32387799-32387821 GAGAGCAAAGTGAAAAATGCAGG + Exonic
1080731933 11:34965385-34965407 AAGTAAAGAGATAAAACTGCTGG - Intronic
1080984551 11:37445895-37445917 GAGTACAGTGAAAAATCTGCTGG + Intergenic
1081043362 11:38239449-38239471 AAGAAAAGAAAGAAAACTGCAGG - Intergenic
1081101035 11:39002324-39002346 GAAAACAGGAAGAGAACTGCAGG - Intergenic
1081322924 11:41713262-41713284 GGGAACAGAGTGAAAAATGAGGG + Intergenic
1081486131 11:43530858-43530880 GAGTACAGAGAGAGAACAGAGGG - Intergenic
1081521919 11:43890023-43890045 GAGATCAGAGAGAACATGGCAGG + Intronic
1082181376 11:49124222-49124244 GAGAGCAGAGAAAACACAGCAGG + Intergenic
1082645741 11:55722044-55722066 GAAAAAAAAGAGAAAAATGCTGG - Intergenic
1083236418 11:61353765-61353787 GAGAACAGAGAGAACCCACCTGG + Exonic
1083295310 11:61712181-61712203 GGGCACAGAGAGAACACAGCAGG + Intronic
1085283718 11:75346701-75346723 GAGAAGAGGGAGGAAACTGACGG - Intronic
1085911059 11:80827368-80827390 GAGAACAGGGAGGAAACTGAGGG + Intergenic
1087638121 11:100726104-100726126 TAGAACAGAGAATTAACTGCAGG + Intronic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1090422852 11:126587507-126587529 GAGAGCACAGTGAAGACTGCAGG - Intronic
1091419468 12:323686-323708 GAGAGCAGAGAGAAAACATGTGG + Exonic
1092788870 12:12054580-12054602 GAGAACATAGATAAAAGTTCAGG - Intronic
1093254620 12:16851500-16851522 GGGATTAGAGAGAAACCTGCAGG - Intergenic
1093872307 12:24306868-24306890 GAGAAAGGAGAGAACACAGCTGG + Intergenic
1094306408 12:29024633-29024655 GAGAACAGCCAGAAAAATGGGGG - Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1094768818 12:33629158-33629180 GAGAACAGAGAGAAATATGGTGG + Intergenic
1095766991 12:45907356-45907378 TAGAAAAGAGAACAAACTGCAGG + Exonic
1096034287 12:48451024-48451046 AAAAAGAGAGAGAAAACTTCAGG + Intergenic
1096775889 12:53963841-53963863 GAGTACAGAGAGAATAATCCGGG - Intergenic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1097862615 12:64533218-64533240 GAGTACAGAGAGACAGCTGATGG - Intergenic
1098138318 12:67426563-67426585 GAGAGCCGAGAGGAAAGTGCTGG - Intergenic
1098215555 12:68213327-68213349 AACAAAAAAGAGAAAACTGCAGG - Intronic
1099253970 12:80292463-80292485 CAGACTAGAGAGAAAACTTCTGG - Intronic
1100065522 12:90639775-90639797 CACAACAGAGAAAGAACTGCTGG + Intergenic
1100133717 12:91527953-91527975 CAGAACCGAGAGAAAACTGGGGG + Intergenic
1100892078 12:99136740-99136762 GGGAACAGGGAGAAGAATGCAGG + Intronic
1101760981 12:107658780-107658802 GAGAATACAGAGAAAACTCTGGG - Exonic
1102527951 12:113525281-113525303 GAGAACAGAGAGGAGACACCTGG - Intergenic
1102814915 12:115858038-115858060 GAGAACAGGGAGAAAGTTGCTGG - Intergenic
1103499073 12:121386775-121386797 TAGAATGGATAGAAAACTGCTGG - Intronic
1103994160 12:124818261-124818283 GAGCACAGAGAAAACACAGCAGG + Intronic
1105480216 13:20768535-20768557 GAGAATAGAGAAAGAACTCCAGG - Intronic
1105916435 13:24921344-24921366 AAGAACAAAGAGAAAGCTGGAGG - Intronic
1106242107 13:27920612-27920634 GGGAACAGAGAGAAGGCTCCTGG - Intronic
1108063104 13:46552834-46552856 GAGAACACGGATAAAACGGCGGG - Intergenic
1108209545 13:48124480-48124502 AAGAACAGAGAGATTACTGTGGG - Intergenic
1109429143 13:62209364-62209386 GAAAAAAGAGAGCAGACTGCAGG - Intergenic
1109665790 13:65534839-65534861 GAAAACAGAGAGAAAACTATAGG - Intergenic
1110362661 13:74644770-74644792 GAAAGTAGAGAGAAAACTGAGGG - Intergenic
1110620448 13:77588426-77588448 GAGGACAAATAGAGAACTGCTGG + Intronic
1110950246 13:81478494-81478516 GTGAACAAAGAGAAAGCTGCTGG + Intergenic
1111649324 13:91069334-91069356 GAGAAAAGAGAAAAAAATGGAGG - Intergenic
1112688400 13:101860318-101860340 GAGTGCATAGAGAAAACTTCTGG - Intronic
1113440759 13:110326360-110326382 GAGGATAGAGAGGAAAGTGCAGG - Intronic
1114340268 14:21736007-21736029 GAGTAGGGAGTGAAAACTGCTGG - Intergenic
1114448121 14:22805564-22805586 GAGAACACATAGACAAATGCGGG + Intronic
1114530699 14:23393918-23393940 GAGAACAGGGAGGAAGCTGATGG + Intronic
1114863677 14:26559698-26559720 GAAGACAGAGAGTAGACTGCTGG + Intronic
1115200420 14:30848277-30848299 GAGACTAGAGAGAAAATTGTAGG - Intergenic
1115276092 14:31610624-31610646 AAAAAAAGAAAGAAAACTGCAGG + Intronic
1115474348 14:33799672-33799694 GAGAAGAGAGAGAAGACACCAGG - Intronic
1116409945 14:44609307-44609329 GAGAACAAAAAGAAAAGTACAGG - Intergenic
1116640661 14:47458465-47458487 GAGAGCAGAGGGTAAACTGGTGG + Intronic
1117461489 14:55949562-55949584 CAGAACAGAAAGAAAAATGCTGG - Intergenic
1117494193 14:56285530-56285552 GAGAACAGAAAGAAAAGGGAAGG + Intronic
1117818469 14:59622820-59622842 GAGCCCAGAGGGAAAACTGCTGG + Intronic
1118490911 14:66258580-66258602 AGGAAAAAAGAGAAAACTGCAGG + Intergenic
1118676717 14:68193915-68193937 GATCACAGAGAGACTACTGCTGG - Intronic
1118884946 14:69858894-69858916 GGGAACAGAGAGGAGGCTGCTGG + Intronic
1119940516 14:78636282-78636304 TAGAAGAGCCAGAAAACTGCAGG + Intronic
1120161802 14:81153800-81153822 GAGCACAGAGAGACACCAGCAGG + Intergenic
1120171654 14:81252155-81252177 CAGAACATAGAGAATACTGCAGG - Intergenic
1120343153 14:83247021-83247043 AGAAACAGAGGGAAAACTGCTGG - Intergenic
1122002283 14:98669032-98669054 GGAAAAAGAAAGAAAACTGCAGG - Intergenic
1122168447 14:99850196-99850218 GAGAACACAGAGAACACTTTGGG - Intronic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122656365 14:103262936-103262958 AAGAAGAAAGAGAAAACTACAGG - Intergenic
1122672341 14:103382291-103382313 GAGGAAAGAGAGAAAAAGGCAGG + Intergenic
1122854545 14:104553926-104553948 GAGAGGAGAGAGGAGACTGCGGG + Intronic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123568733 15:21579796-21579818 GACAAGAAAGAGAGAACTGCAGG - Intergenic
1123604842 15:22015117-22015139 GACAAGAAAGAGAGAACTGCAGG - Intergenic
1125344175 15:38702319-38702341 GAGAACAAACAGAAATATGCAGG - Intergenic
1125860175 15:42991654-42991676 GAGAACAGACAGAAAAGAGATGG - Intronic
1126294233 15:47119396-47119418 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1126464654 15:48950877-48950899 GAGAACTGAGAAAGAACCGCAGG - Intronic
1127067049 15:55251449-55251471 GGGGCAAGAGAGAAAACTGCAGG + Intronic
1127590785 15:60420573-60420595 GAGATGAGAGAGAAAACTGCAGG - Exonic
1128151573 15:65366590-65366612 GAGAAGAGAGAGAGAAGGGCGGG + Intronic
1130023474 15:80251035-80251057 GAGAACTGAGAAGAACCTGCCGG + Intergenic
1130090185 15:80814415-80814437 TGGAGCAGAGAGAGAACTGCTGG - Intronic
1130102632 15:80905565-80905587 GAGAATGGAGAGAAAACAGAGGG + Intronic
1130913648 15:88288622-88288644 GAAAACAGAGAGAAAAGAGGAGG + Intergenic
1131355638 15:91743350-91743372 GAGAAAACAGAGAAAACTCAAGG - Intergenic
1131459173 15:92606478-92606500 GAGACCAGTTAGGAAACTGCAGG + Intergenic
1202977088 15_KI270727v1_random:306886-306908 GACAAGAAAGAGAGAACTGCAGG - Intergenic
1133246624 16:4453352-4453374 GCGAACAGAGAGGGAACTGGGGG + Intronic
1133320432 16:4910211-4910233 GAGAAGAGAGATAAAATAGCTGG - Intronic
1133609002 16:7415629-7415651 GAGAACAGAGAATACAATGCTGG - Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1134234840 16:12457369-12457391 GAGAACAGAGGTTAAAGTGCAGG - Intronic
1135576207 16:23587806-23587828 GAGATCAGGGAGATAACTGCTGG - Intronic
1136860620 16:33699550-33699572 GAGAAAAGAGAGAGAACAGAGGG - Intergenic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1138566628 16:57838164-57838186 AAGAACAAAGAGAAAAATGCAGG + Intronic
1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG + Intergenic
1139323987 16:66137491-66137513 GAAAACAAAGATAAAACTTCAGG + Intergenic
1139658551 16:68404484-68404506 GATAAAACAGAGAAAACAGCTGG - Intronic
1140113164 16:72020771-72020793 GAGAACAGAGAGAACTCAGTAGG - Intronic
1203122121 16_KI270728v1_random:1547733-1547755 GAGAAAAGAGAGAGAACAGAGGG - Intergenic
1142484627 17:238744-238766 GTGCACAGAGAGAGAGCTGCTGG - Intronic
1142751494 17:1991131-1991153 TAGAACAGACAGAAATCAGCTGG - Intronic
1143128501 17:4660656-4660678 GAGAACAGAGAGAGGACTAGTGG + Intergenic
1143729659 17:8874011-8874033 CAGAACAGAGAGAAACAAGCTGG + Intergenic
1143921116 17:10331789-10331811 GAGAACATAGAGAGGACTCCAGG - Intronic
1143980607 17:10866265-10866287 GAGAGCAGAGAGGAAATTACTGG - Intergenic
1144221522 17:13104304-13104326 GAGCACAGAGCCAAAGCTGCTGG - Intergenic
1144787199 17:17838439-17838461 GAGAACACAGAGAACAAAGCTGG + Intergenic
1146583112 17:34057600-34057622 TACAACAGAAAGAAAATTGCAGG + Intronic
1146821606 17:35987177-35987199 GAGATGAGACAGAGAACTGCAGG - Intronic
1146918917 17:36696764-36696786 GAGAACAGAGAGAGCACTGTAGG + Intergenic
1147053826 17:37818593-37818615 AACTACAGAGAGAAAAGTGCTGG - Intergenic
1149556929 17:57580095-57580117 GGGAACAGAGAGGAGACAGCTGG - Intronic
1149626099 17:58082293-58082315 CAGACCAGAAAGAAAACCGCAGG + Intergenic
1152144265 17:78558759-78558781 GAAAGCAGAGAGAAAACAGAAGG - Intronic
1153609792 18:6872079-6872101 GGGAAAAGAGAGAAGCCTGCAGG + Intronic
1154509187 18:15077140-15077162 CATAACAGAAAGAAAACTACAGG - Intergenic
1154978318 18:21480711-21480733 AAGAACACACAGAAAACTGATGG + Intronic
1155428809 18:25734239-25734261 GGGAGGAGAGAGAAAACTGGAGG - Intergenic
1155807220 18:30186747-30186769 CAGAACAGTGACAAAACTTCTGG + Intergenic
1155828927 18:30486979-30487001 AAGACCATAGAGAAAACTTCTGG + Intergenic
1155976554 18:32138215-32138237 GAAAACAGAAAAAAATCTGCAGG - Intronic
1156215959 18:34998306-34998328 AAAAAGAGAGAGAAAAATGCTGG - Intronic
1156372707 18:36485523-36485545 CAGTTCACAGAGAAAACTGCTGG - Intronic
1156585270 18:38424938-38424960 GTGAACAGAGATAAAAATCCTGG - Intergenic
1157275719 18:46310033-46310055 GAGCACAAGGAGTAAACTGCAGG + Intergenic
1158118028 18:54018383-54018405 AAGAACAGGCAGAAAACTACTGG + Intergenic
1158747387 18:60217198-60217220 GAGAACAGAGAGAACAGAGCTGG + Intergenic
1158780890 18:60649384-60649406 GAGAACAAAGAGACAGCAGCTGG + Intergenic
1158912102 18:62074803-62074825 GAGAACAATGAGAAAAAGGCTGG + Exonic
1159636422 18:70810162-70810184 GAACAGAGAGAGAAAACAGCTGG + Intergenic
1159833220 18:73303948-73303970 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1160213275 18:76902556-76902578 GAAAAAAGAAAGAAAAATGCAGG - Intronic
1161662794 19:5557640-5557662 GAGAACAGAGAGATAGAGGCAGG + Intergenic
1161984430 19:7645853-7645875 GAGAACAGAGAGAAAGGGGAAGG - Intronic
1163569711 19:18073721-18073743 CAGAAAAGAGAAAAAACTGAAGG + Intronic
1163654207 19:18536341-18536363 GAGAACAGAAAAAAAAGTTCTGG - Intronic
1164943986 19:32274944-32274966 GAGAACACAGAGAAAAATATGGG + Intergenic
1165617251 19:37212779-37212801 CAGAAGAAAGAGAAAACTACAGG - Intronic
1165739714 19:38197981-38198003 GAGAACAGAGGCAACACGGCCGG - Intronic
1167061083 19:47146889-47146911 GATATCTGAGAGAAAACGGCTGG + Intronic
1167614915 19:50527326-50527348 GAAAAAAGAAAGAAAACAGCCGG - Intronic
1167881954 19:52466492-52466514 AAAAACATAGAGAAAACTGTTGG - Intronic
1168062968 19:53904315-53904337 TAGAAGAGAGGAAAAACTGCAGG - Intronic
925057563 2:866881-866903 GAGAGCAGAGAGGAAAGGGCTGG - Intergenic
925306103 2:2849093-2849115 GGGGACGGAGAGAGAACTGCAGG + Intergenic
925589266 2:5493668-5493690 GAGAACAAAGAGAACCCTGAGGG + Intergenic
925648639 2:6064929-6064951 AAGAAAAGAGAGAAAATTGCTGG + Intergenic
927503082 2:23595321-23595343 TAAAACAGAGACAAAAATGCTGG - Intronic
927710639 2:25323678-25323700 AAGAAAGGAGAGAAATCTGCGGG - Intronic
927810302 2:26176612-26176634 CAGAACAGAATGAAAACTGCTGG - Intronic
927823478 2:26289828-26289850 GAGAACAAGGAGAAAAGTACAGG - Intronic
928332703 2:30369854-30369876 GAGCACAGAGAGTAACCTCCAGG - Intergenic
928350282 2:30546107-30546129 GAGATCAGAGAGAAGCCAGCAGG + Intronic
928476241 2:31630323-31630345 GAGAAAAGAGAGAAAAGAGAGGG + Intergenic
929238528 2:39629319-39629341 GAGAAGATAGAGAAAACTCATGG - Intergenic
929344374 2:40863206-40863228 ATGAACAGAGGGAAAAGTGCAGG + Intergenic
931720617 2:65064966-65064988 CAGAAGAGAGAGAAGACTGGTGG - Intronic
931784688 2:65608514-65608536 GGGAACAGAGAGAAAAATTAAGG - Intergenic
932032644 2:68206143-68206165 AAGAACAGAGAGAAACTTCCAGG + Intronic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
934733100 2:96671844-96671866 GAGGACTGAGAGATATCTGCTGG + Intergenic
934982261 2:98852780-98852802 AAGAACAGAGAGAAAAAGACTGG + Intronic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
935212045 2:100946493-100946515 GAGAACAGAAGGCAAACTGGAGG + Intronic
935271677 2:101440216-101440238 CAGAAAAGAGATAACACTGCAGG + Intronic
935791458 2:106594821-106594843 GAAAACAGTGAGAAAACATCAGG - Intergenic
935929091 2:108104081-108104103 GAGAAAAGAGAGGAAAATGAAGG + Intergenic
936036804 2:109119745-109119767 AAGAAAACAGAGACAACTGCAGG + Intergenic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
937103413 2:119289074-119289096 GAGAATACAGAGAGAATTGCTGG + Intergenic
937216555 2:120316941-120316963 AAGAACAGGGAGAAGACAGCTGG - Intergenic
938077581 2:128347965-128347987 GAGCAGAGAAAGAAGACTGCAGG - Intergenic
938099417 2:128488126-128488148 GAGGTCAGAGTCAAAACTGCAGG + Intergenic
938638734 2:133257740-133257762 GAGACCAGAGAGACAAATGAAGG + Intronic
939474470 2:142668988-142669010 CAGAAGAGAGAGAAAACTCATGG - Intergenic
939922549 2:148135038-148135060 GAGGACAGAGAGAAAAGAACTGG - Intronic
940199427 2:151133580-151133602 GACAAAAAAGAGAAAACTGAGGG + Intergenic
941201819 2:162520887-162520909 AAGAACAGAGATGAAGCTGCAGG - Intronic
941247746 2:163121886-163121908 AAAAACAGGCAGAAAACTGCAGG - Intergenic
942108838 2:172660069-172660091 GAGAAAATAGAGAAAGGTGCAGG + Intergenic
942179652 2:173367858-173367880 GGGAGCAGAGAAGAAACTGCAGG - Exonic
944259326 2:197658707-197658729 AAGAACTGAGAAAGAACTGCTGG - Intronic
944476584 2:200112673-200112695 GAGTGCAGAGAGAAATGTGCTGG + Intergenic
945623776 2:212174073-212174095 CTGAACTGATAGAAAACTGCAGG + Intronic
946037889 2:216758434-216758456 CAGATTAGAGAGAAAGCTGCTGG + Intergenic
947504768 2:230699279-230699301 AGGAAAAGAAAGAAAACTGCTGG + Intergenic
948200880 2:236128951-236128973 GAGTTCAGATAGAAAAGTGCTGG + Exonic
948750762 2:240131501-240131523 GAGAGCAGAGGGAAACCAGCCGG + Intronic
948959327 2:241319892-241319914 GAAAACAGTAAGAAAACTGCTGG - Intronic
1168966328 20:1900620-1900642 AAGAACAGAGAGAAAAAAACTGG + Intronic
1169403130 20:5300817-5300839 GAGGACAGAGAAAAAAGTGGAGG - Intergenic
1170053569 20:12174148-12174170 GAGAGCTGAAAGAAAACTGTAGG + Intergenic
1171271795 20:23823882-23823904 GAGAAGACAGAGAAGGCTGCAGG - Exonic
1172741628 20:37172947-37172969 GAGAAGAAGGAGAAAAATGCAGG - Intronic
1172860700 20:38048689-38048711 GAGAACAGAGAGCAAAAGTCAGG - Intronic
1172870625 20:38133352-38133374 GGGAACAGAGAGGAAACAGAGGG - Intronic
1173496949 20:43526378-43526400 GAGAAGAGAGAGTAGACTTCAGG - Intronic
1173658018 20:44714514-44714536 GAAAACAGAGGGAAAACAGGTGG - Intergenic
1173910098 20:46661808-46661830 GAGAACAGACAGAAAACCTGAGG - Intronic
1174168097 20:48599100-48599122 GAGGACAGAGAGACAAGTGTGGG + Intergenic
1175420512 20:58829507-58829529 GAGAACAGAGATGAATCTGGAGG - Intergenic
1175428943 20:58889482-58889504 GAGAAAAGAGAGAGAATTGGGGG - Intronic
1175686270 20:61030982-61031004 GAGTACAGAGAGCATCCTGCAGG - Intergenic
1176268770 20:64224426-64224448 GGGAACAGAGACAAGGCTGCTGG - Intronic
1176655336 21:9583825-9583847 GAGAACACAAAGAAAACTCAAGG - Intergenic
1177303124 21:19276709-19276731 GAGAGCAGAGGAAAAACAGCTGG - Intergenic
1177447843 21:21221199-21221221 GAGAAGAGGGAGAAAAATGAGGG - Intronic
1177759709 21:25389606-25389628 GGGAAAAGAGAAAAAACTGATGG - Intergenic
1178166386 21:29983024-29983046 GTGAACAGAGAGGAAATTTCTGG - Intergenic
1178303353 21:31470802-31470824 GAGAAGAGAGAGGAACCGGCAGG + Intronic
1178365908 21:31988636-31988658 GAGAAAAGAGAGAAAAATGAGGG - Intronic
1178373361 21:32046379-32046401 GAGAACTGAGTGAAATCTGAAGG - Intergenic
1178920119 21:36733195-36733217 AAGCACAGAGACAAAACTGAGGG + Intronic
1179084395 21:38204579-38204601 GAGAGCTGAGTGAAACCTGCTGG + Intronic
1179396153 21:41041919-41041941 GAGAAGAAAAAGAAAACTACAGG + Intergenic
1180317108 22:11285007-11285029 GGGGAGAGAGAGAAAAGTGCAGG + Intergenic
1181094756 22:20497370-20497392 GAGTCCAGAGAGATAACTGAGGG + Intronic
1182502639 22:30758584-30758606 GAGCAGACAGAGAAAACTCCTGG + Intronic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1182845617 22:33428624-33428646 TAAAAAAGAGAGAGAACTGCTGG + Intronic
1183244713 22:36685104-36685126 GAGAACACAGAGAAACCAGGCGG - Intronic
949658438 3:6248930-6248952 TACAACAGAGAGAAACCTGGAGG + Intergenic
949724195 3:7024532-7024554 GGGCACAGAGAGGTAACTGCTGG + Intronic
950191400 3:10978940-10978962 AAGAACACAGTGAAAACTGGTGG + Intergenic
950276600 3:11666459-11666481 GAGAACAGAGAGAAAGGAGATGG + Intronic
950915290 3:16638356-16638378 GAGAGTAGTGGGAAAACTGCAGG - Intronic
952212827 3:31246788-31246810 GAGAAAAGGCAGAAAACAGCTGG + Intergenic
952470516 3:33645455-33645477 GGGAAGAGAAAGAAAAATGCCGG - Intronic
953044273 3:39281191-39281213 GAACAAAGAAAGAAAACTGCTGG - Intronic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953744881 3:45566752-45566774 GAGAACAGAGAGCAAGATGGGGG + Intronic
953797538 3:45996855-45996877 GAGAACAGAAAGAAAACGGGGGG + Intergenic
954471766 3:50703293-50703315 GAAAAAAAAGAGAAAACTACAGG - Intronic
954503965 3:51050633-51050655 GAGAACTGAGAGACAAATGGAGG + Intronic
954766662 3:52923789-52923811 GAGAAAAGAGACAAAACGGAAGG + Intronic
954973113 3:54668238-54668260 GAGAAAAGAGAAAAAACTCAAGG - Intronic
955673337 3:61425101-61425123 GACTACAGAGAGAGAAATGCGGG + Intergenic
956043418 3:65170470-65170492 GAGAATAGAGCAAAAACTGTAGG - Intergenic
956464829 3:69509032-69509054 GGGAGCAGAGACAAAACTTCTGG - Intronic
956555477 3:70517635-70517657 GAGGACAAAGAGAAAAATCCAGG + Intergenic
957801125 3:85083311-85083333 GAAGGCAGAGAGAAAAGTGCAGG - Intronic
958196733 3:90250784-90250806 GAGAACAAAAAGAAAAGTACTGG - Intergenic
958420168 3:93920675-93920697 GAGAACAAAAAGAAAAGTACTGG - Intronic
958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG + Intergenic
959148016 3:102573053-102573075 GACAAAAAAGAGAATACTGCAGG + Intergenic
960470259 3:118055609-118055631 GAGAAAAGTGAGAAAGCAGCTGG + Intergenic
961920600 3:130421411-130421433 GAGAACTGAGATAAACCTGTAGG + Intronic
962252633 3:133846072-133846094 AAGCACAGAGAGAAAAATGATGG + Intronic
962583341 3:136818238-136818260 CAGAACCTGGAGAAAACTGCAGG + Intergenic
963277149 3:143343526-143343548 TACTACAGAGAGAAAACTGCAGG + Intronic
964076230 3:152695660-152695682 GAGAGAGGTGAGAAAACTGCAGG + Intergenic
964119899 3:153172857-153172879 GAGAAGGGAGAATAAACTGCAGG + Intergenic
964185492 3:153937729-153937751 TAGAAAAGAGAGAACCCTGCTGG - Intergenic
964882325 3:161437256-161437278 GAAAAAAGCAAGAAAACTGCTGG + Intergenic
965078702 3:164010261-164010283 GAGAACACACAGAAAAAGGCAGG + Intergenic
965370915 3:167861672-167861694 GGGAGCAGAGAGAAACTTGCAGG - Intergenic
965973732 3:174595217-174595239 GAGGAGAAAGAGAAAACTGATGG - Intronic
966917815 3:184594528-184594550 GACAACAGAGAGAATCCTGAGGG - Intronic
969979760 4:11142521-11142543 GTGAATACAGAGAAAACTTCTGG - Intergenic
970484640 4:16512605-16512627 GAGAACAGAGTGGCAACTACAGG + Intronic
970838461 4:20438688-20438710 GAGATCAGAGAGTTAACAGCAGG - Intronic
971036954 4:22704145-22704167 TAGAACAGAAGGAAAACAGCAGG - Intergenic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
971564796 4:28124277-28124299 GAGAGAAGTGAGGAAACTGCAGG - Intergenic
971849673 4:31968086-31968108 GAGAAGAGAGAGAAGAGGGCTGG - Intergenic
971927468 4:33031553-33031575 GAGAATAGAGAAAGAATTGCTGG - Intergenic
972376008 4:38471174-38471196 GAGAAAAGAGAGAAAAGTCATGG - Intergenic
972977480 4:44654482-44654504 GAGTTCAGAGAGAGAACTGAGGG - Intronic
973635540 4:52858896-52858918 GTGAACAGAGAGAAAAGCCCTGG - Intergenic
973817442 4:54631913-54631935 AAGACCAGAGAGAAAACAGAAGG + Intergenic
974273652 4:59686970-59686992 GAAAACAGTGTGAAAACTTCTGG + Intergenic
975501442 4:75089896-75089918 GAGAATAGAGAGAAAAATGTGGG - Intergenic
975837282 4:78437583-78437605 GAGAACAGACTGAAACCTGTTGG + Intronic
976391796 4:84513283-84513305 CTGATCAGAGAGAAAGCTGCGGG + Intergenic
976968255 4:91072162-91072184 GAGAACTGCTAGAAAACTGGGGG + Intronic
979101613 4:116623699-116623721 CAGATCAGTGAGAAATCTGCAGG + Intergenic
979734040 4:124060396-124060418 GAAAACAGAGAAAAAAGTGTTGG - Intergenic
979930279 4:126621400-126621422 AAGAAAAGAAAGAAAACTACAGG + Intergenic
980401715 4:132296151-132296173 CACAACAAAAAGAAAACTGCAGG + Intergenic
980545140 4:134251217-134251239 GATAACAAAGAGAAAACTACAGG - Intergenic
980647827 4:135666336-135666358 GAGAACAGAGAGGAAGTGGCAGG - Intergenic
982349661 4:154400804-154400826 GTGGACAGAGAGCAAACTGGTGG - Intronic
982804663 4:159748917-159748939 GAAAACAGAGAAAAACCTTCTGG - Intergenic
984312806 4:178084886-178084908 AAGAAAAGAGAGAAAACAACCGG + Intergenic
985229484 4:187799355-187799377 GAAACCAGAGAGAAAACTAAAGG + Intergenic
986126484 5:4886838-4886860 GAGCACAGATCGAAAACCGCTGG - Intergenic
986266054 5:6191234-6191256 GAGACCAGAGAGGATAGTGCAGG - Intergenic
986990670 5:13549291-13549313 AGGAACAGAGAGAGAACTCCTGG + Intergenic
987604973 5:20122309-20122331 AAAAACATAGAGAAAACAGCAGG - Intronic
989172068 5:38481809-38481831 GAGGACTTAGATAAAACTGCGGG - Exonic
989630343 5:43475699-43475721 GAGAACCAACAGAAAACTGTTGG + Intronic
990625752 5:57608658-57608680 GAGAACAGAGAGAGAAAGGAAGG + Intergenic
990756015 5:59071321-59071343 TAGAAAAAAGAGAAAACTGCAGG - Intronic
991954668 5:71982462-71982484 AAGAACAGAGAGAAAGAAGCAGG - Intergenic
992594614 5:78332906-78332928 GAGAATATAAAGAAAACTGAGGG + Intergenic
992677797 5:79123184-79123206 GAGAACAGAGAAGCAGCTGCTGG + Intronic
992862615 5:80927604-80927626 GAGGAAAGAGAGAAAGCTGTGGG + Intergenic
993061384 5:83042938-83042960 GAGAACAAAAACAAAAATGCAGG - Intergenic
993300142 5:86198585-86198607 AAGAACAGTGAGAAAGCTGGAGG + Intergenic
993462368 5:88199466-88199488 GGGGAAAGAAAGAAAACTGCAGG + Intronic
993592953 5:89818145-89818167 GAGAACAGATAGAAAGCAGATGG + Intergenic
993611659 5:90061649-90061671 GAGACCAGGAAGAAAACTGATGG + Intergenic
994435403 5:99724050-99724072 GAAAACAGAGAGAAATCAGACGG - Intergenic
994471628 5:100215262-100215284 GATAACAGAGAAAAAGTTGCAGG - Intergenic
994672937 5:102784199-102784221 AAGAACAGAGAGAAAGATGGGGG - Intronic
994750393 5:103730368-103730390 TAGAACAGAGAGAGAAATGAAGG - Intergenic
995022304 5:107380516-107380538 GTGAAAACAGAGAAAACTACAGG - Exonic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
995686856 5:114781164-114781186 GAGAACAGAGGGAAAGGTCCAGG - Intergenic
996500278 5:124208985-124209007 GGGAAGGGAGAGAAAAATGCAGG + Intergenic
996719939 5:126620083-126620105 GAGAACAGCCAGAAAACTTAAGG - Intronic
996864243 5:128101653-128101675 GAGAACAGAAACAAAACTTCTGG - Intronic
998114354 5:139524749-139524771 GAGAACAGAGAAAAAGCTATAGG + Intergenic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
999016965 5:148117371-148117393 TAGAAGAGAGAGAAAAATGCTGG - Intronic
1000161011 5:158597809-158597831 AAGAACAGAGAGAAGAATGGTGG + Intergenic
1000367755 5:160506732-160506754 GAGAAAGGAAAGAAAGCTGCTGG - Intergenic
1002145524 5:177177744-177177766 CAGAGCAGAGAGAAAACTCTGGG - Intronic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1002605848 5:180382219-180382241 AAGAGCAGAGAGAAAAGTGCTGG + Intergenic
1003087976 6:3076734-3076756 GAAAACAGAGAGAAAACCTCAGG - Intronic
1003344329 6:5252588-5252610 GACAGCAGAGAGAAAACGGTGGG - Intronic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1003794211 6:9581729-9581751 GAGATCAAAGAGACTACTGCAGG + Intergenic
1003990336 6:11480544-11480566 GAGAACAGAGGGAAATGGGCAGG + Intergenic
1004039930 6:11965503-11965525 GAGAGAAGGGAGAGAACTGCAGG + Intergenic
1004573666 6:16872099-16872121 GAGAAAGGAGAGATAACTGCAGG - Intergenic
1004773015 6:18807614-18807636 GAGGAAAGACAGAAATCTGCAGG - Intergenic
1006547666 6:34792692-34792714 GAAAGCAGAGAGAAGACAGCTGG - Intronic
1006737357 6:36283953-36283975 GAAAACAGAGAGAAAAGAGCAGG + Intronic
1006869677 6:37240058-37240080 GAGGCGAGACAGAAAACTGCTGG + Intronic
1007228337 6:40330269-40330291 GAGGACAGTGAGAAGGCTGCTGG - Intergenic
1007815870 6:44525291-44525313 GAGACCAGGGAGGAGACTGCAGG - Intergenic
1007946896 6:45834960-45834982 GAGAACAGAGAACAAAGTACAGG + Intergenic
1008552964 6:52650782-52650804 AAGAACAGAGAGAGAGCTGCAGG + Intergenic
1008556756 6:52679781-52679803 GAGATCAGACAGCAAACAGCAGG - Intronic
1009616770 6:66019029-66019051 GAGGACAGAGGGAAAATTGTAGG + Intergenic
1009630229 6:66188741-66188763 TAGAAAAGAGAGAAAACTATGGG + Intergenic
1011218649 6:85031854-85031876 GAGAAGAGAGAGAAGAGGGCAGG + Intergenic
1011759404 6:90544872-90544894 AAGAACAGAGACAAAGCTGCAGG + Intronic
1012120797 6:95364848-95364870 GGGAACAGAGAAAAAACTACAGG - Intergenic
1013515196 6:110878578-110878600 GAAAAATCAGAGAAAACTGCAGG - Intronic
1013972152 6:116033714-116033736 TAAGTCAGAGAGAAAACTGCTGG + Intronic
1014167790 6:118245530-118245552 AAGAAGAGAGAGACAACTGCTGG - Intronic
1014293588 6:119590169-119590191 GAGAACAGAGGAAAAAAAGCAGG + Intergenic
1016750748 6:147628790-147628812 GAGAACAGAGAGCAAATCACTGG + Intronic
1017221058 6:151966548-151966570 GAAAACAAAGAGAAAAATGTAGG - Intronic
1017576825 6:155814686-155814708 GAGAACAAAGATAATACTACAGG + Intergenic
1017741885 6:157413903-157413925 TAGCACAGAGAGAAATGTGCTGG - Intronic
1018350700 6:162956029-162956051 GGGAGCAAAGAGAAAACAGCAGG - Intronic
1018636799 6:165868710-165868732 TAGAAAAGAAAGAAAACTACAGG + Intronic
1018894828 6:168006580-168006602 GAGAACAGTTAAAAAAATGCTGG + Intronic
1021141489 7:17030881-17030903 AAGAACAGTGAGAAAACTAGTGG - Intergenic
1021402101 7:20220956-20220978 TAGGACAGAGAAAAAACTCCAGG - Intergenic
1021912693 7:25401934-25401956 GAGAAGACAGAGAAAATTTCAGG + Intergenic
1022045429 7:26618763-26618785 GAGAGCAGAGGGAAAGCTGAAGG + Intergenic
1022845619 7:34206892-34206914 GAGAAAAAAGAGAAAATGGCAGG + Intergenic
1023679694 7:42672928-42672950 GAGATCTGATAGAAAACAGCTGG - Intergenic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1024403644 7:48952443-48952465 AAGAACAGAGAAAAAATTACTGG - Intergenic
1024407018 7:48993533-48993555 GAAAATAGAGAGATAACTGGAGG - Intergenic
1024803341 7:53107047-53107069 TAGCACAGAGAGAAAAGTGGAGG + Intergenic
1026169931 7:67945104-67945126 GAAAAGAGACAGAAAACAGCAGG - Intergenic
1026302796 7:69112454-69112476 GAGAACAGAAAGAGAATTACTGG + Intergenic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1027505460 7:79012366-79012388 CAGAGCAGAGAGAAGACTTCCGG - Intronic
1028109863 7:86927063-86927085 GAGAAAAGAGAGAACATTGGTGG + Intronic
1028291321 7:89068587-89068609 GGGAATAGAGAGCAAACTACTGG + Intronic
1028571877 7:92298053-92298075 GAGAACAGAAAGAATACTGGAGG - Intronic
1028775248 7:94668944-94668966 GACAACAGAGAACAACCTGCTGG + Exonic
1029128093 7:98309147-98309169 CAAAAAAGAAAGAAAACTGCTGG - Intronic
1030545296 7:110886730-110886752 TAGAAAAGAGATCAAACTGCTGG + Intronic
1030675102 7:112376132-112376154 GAAAACAGAAAGAAAACTGAAGG - Intergenic
1031287113 7:119884660-119884682 GAGCAAAAAGACAAAACTGCAGG - Intergenic
1031299841 7:120051444-120051466 GTGATAAGAGAGAAGACTGCTGG - Intergenic
1032954247 7:136951900-136951922 AAGAAGAGAGAGAAAAGAGCAGG - Intronic
1033035832 7:137875455-137875477 GAGAACAGAGCTAAAACCCCTGG + Exonic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1037005827 8:13778510-13778532 GAGAACAAAGAGATAATGGCAGG - Intergenic
1037191788 8:16134952-16134974 GAGAAAGGTGAGGAAACTGCAGG + Intronic
1038296301 8:26293252-26293274 TAGAACGAAGAGAAAACTTCGGG - Exonic
1038559826 8:28564286-28564308 CAGAAGAGAAAGAAAAATGCTGG + Exonic
1038602475 8:28960003-28960025 GAGAAAAGAGAGAAAAAAACTGG - Intronic
1039050931 8:33492492-33492514 GAAAACACTGAGAAAACTCCAGG - Intronic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1040654474 8:49489980-49490002 GAAAACAGATACAAAACAGCAGG - Intergenic
1041205069 8:55491021-55491043 AAGCACAGAGAGAAAAAGGCTGG - Intronic
1041873442 8:62661210-62661232 GTGGAAAGAGAGAAAACAGCAGG - Intronic
1042556683 8:70039284-70039306 GAGAACAGTGACAAGAGTGCAGG + Intergenic
1043083488 8:75796932-75796954 AAGAACATAAAGAAAACTTCTGG + Intergenic
1043274697 8:78378507-78378529 TAGAAAATAAAGAAAACTGCAGG - Intergenic
1043356659 8:79421433-79421455 GAGTGCAAATAGAAAACTGCAGG - Intergenic
1044376139 8:91473278-91473300 GAGAATAGAGTGAGATCTGCTGG + Intergenic
1044687090 8:94836835-94836857 AAAAACAGAGAGAAAAAAGCTGG - Intronic
1044962378 8:97543135-97543157 GAGGACAGAGAGACAACAGGTGG + Intergenic
1045626118 8:104052950-104052972 GTGAACTGAGAGAAAAGTACAGG + Intronic
1045749669 8:105468247-105468269 GAGCAAAGAGAGAAAATGGCAGG - Intronic
1046620889 8:116528486-116528508 AAGGTCAGAGAGAAAGCTGCTGG - Intergenic
1046869069 8:119184649-119184671 GAAAAGAGAGAGAAGAATGCTGG + Intronic
1047054901 8:121153077-121153099 GAGAGAAGAAAGAAAACTGGAGG - Intergenic
1047401947 8:124555671-124555693 GTGAGGAGATAGAAAACTGCTGG - Intronic
1047462865 8:125085478-125085500 GAGAACAGAGAGAGAAGCGGAGG + Intronic
1047651717 8:126930119-126930141 GAGAACACAGAAAAAAAAGCAGG + Intergenic
1048181362 8:132197600-132197622 GAGAAGAAAGAGAAAACATCTGG - Intronic
1048897908 8:139010620-139010642 TAGGACAGAGAGAATAGTGCAGG + Intergenic
1049430631 8:142562243-142562265 AACAACAGAGAGAAAAGTGATGG - Intergenic
1049451913 8:142666533-142666555 GGGAACAGAGAGGAAAGTGATGG + Intronic
1050322157 9:4463915-4463937 GAGAACTGAGTGAGAACTGAGGG + Intergenic
1050491407 9:6192237-6192259 AAGAACAGAGAGAAAAATAATGG - Intergenic
1050952071 9:11610111-11610133 GAGAACTGAGGGAAAAATGAGGG + Intergenic
1051993897 9:23189930-23189952 GAAAACATAGAGAGAGCTGCTGG - Intergenic
1052003941 9:23323672-23323694 GATAGCAGAGAGAAAGCTGGTGG + Intergenic
1052206034 9:25841528-25841550 AGGAACAGAGAGAAAAATGCTGG + Intergenic
1052396122 9:27940465-27940487 GAGAAAAGTGAGAAACCTGAGGG - Intergenic
1054755833 9:68956902-68956924 GGGAACACAGAGGAGACTGCTGG - Intronic
1055107119 9:72524770-72524792 GAGAAGAGAGAGAAATCTTAAGG + Intronic
1055707212 9:79018588-79018610 GAAGACAGAGAAAATACTGCAGG + Intergenic
1056499445 9:87193462-87193484 TAGCAGAGAGAGAAAACTTCAGG + Intergenic
1057297537 9:93858237-93858259 GAGTACAGAGAGAAATCTGATGG - Intergenic
1058031429 9:100202372-100202394 GAGAACCCAGAGAGAACTTCAGG + Intronic
1058190430 9:101907975-101907997 AAGAAAAGAGAAAAAAATGCTGG + Intergenic
1058372680 9:104288125-104288147 TAGAAGAGAGAGAAAACTGGAGG + Intergenic
1059534002 9:115064224-115064246 GAGCAAAGAGAGGAAAGTGCAGG + Intronic
1059695838 9:116729280-116729302 TAGAGCAGAGAGAAAAATGAGGG - Intronic
1062324608 9:136006054-136006076 GTGAACAGAGAGACAAGTGCAGG - Intergenic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1203633054 Un_KI270750v1:87297-87319 GAGAACACAAAGAAAACTCAAGG - Intergenic
1188443635 X:30234914-30234936 GAGACCTGAGAGAAAACTAAAGG + Intronic
1188764216 X:34072326-34072348 GAGAGAGGAGAGAAAAGTGCAGG - Intergenic
1189634045 X:42986002-42986024 GAGATCAGAGAGAAAACTTGAGG + Intergenic
1189688140 X:43587291-43587313 CAGAACAGAGAGAAAACCAAAGG + Intergenic
1191728949 X:64313378-64313400 GAGAAAAGTGAGGAAGCTGCAGG - Intronic
1191998744 X:67125549-67125571 TAGAATAGAGAGAAAAGTGGAGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1192877317 X:75245318-75245340 GAGAAAAGAGAACACACTGCGGG + Intergenic
1194375277 X:93124978-93125000 GAGAATAGAGAGAAAACTGGCGG + Intergenic
1194893987 X:99416091-99416113 GATAGCAGAGACAAGACTGCAGG - Intergenic
1195341275 X:103908583-103908605 AAGAAAAGAAAGAAAACTCCAGG + Intergenic
1195785086 X:108510633-108510655 TAGAACAGAGAGAAAAGGGGAGG + Intronic
1196745023 X:119063954-119063976 GATAAAAGAAAGAAAAATGCTGG - Intergenic
1196859060 X:120010505-120010527 GAGAAGAGAGAAAAAATTGAAGG + Intergenic
1197409683 X:126099924-126099946 GAGAAAAGAAAGAAAAATGTTGG - Intergenic
1197437805 X:126453722-126453744 AAGAACAGAGAGAATTGTGCAGG + Intergenic
1197488967 X:127092334-127092356 GAGAACAGAGAGACAATTATTGG + Intergenic
1197613312 X:128663234-128663256 GAGGACTGAGAGAAAACCTCAGG - Intergenic
1198420196 X:136464224-136464246 AACAACAGAGAGAAAACTGGAGG - Intergenic
1198604918 X:138326442-138326464 TAGAAAAGAGAGAAAAATGCTGG - Intergenic
1199166415 X:144680643-144680665 GAGTACAGAGAGAAAATGTCTGG - Intergenic
1199339932 X:146665708-146665730 GAAAAAAGAAAGAAAACTGTAGG + Intergenic
1200290479 X:154867731-154867753 AAGAAAAGAAAGAAAACTACAGG + Intronic