ID: 1133740380

View in Genome Browser
Species Human (GRCh38)
Location 16:8646830-8646852
Sequence CAGAGAGACCAAGGGGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133740380_1133740386 10 Left 1133740380 16:8646830-8646852 CCCTCCGCCCCTTGGTCTCTCTG 0: 1
1: 0
2: 0
3: 27
4: 304
Right 1133740386 16:8646863-8646885 TGTGTACATGTCTGTCTGTCTGG 0: 1
1: 1
2: 5
3: 79
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133740380 Original CRISPR CAGAGAGACCAAGGGGCGGA GGG (reversed) Exonic
900574991 1:3378661-3378683 CACAGAGACCCTGGGGAGGAAGG + Intronic
900700779 1:4047477-4047499 CAGGGAGAGGAAGGGGAGGAAGG + Intergenic
900703565 1:4062438-4062460 CAGAGAGAGCGAGGGACAGATGG - Intergenic
900766996 1:4512434-4512456 CAGAGAGAGAAAGAGGGGGAGGG + Intergenic
900937623 1:5776529-5776551 CAGCCAGACCAAGGGGCTGAAGG - Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901330990 1:8408361-8408383 CAAAGAGAGCAAGAGGAGGAGGG + Intronic
901634976 1:10666324-10666346 CAGAGAGGCCAAGAGGGGGCTGG - Intronic
902375153 1:16027016-16027038 CAGAGAGGCCAAGGGGCCAGTGG - Intronic
902847856 1:19126354-19126376 CAGAGAGCTCAAGGGGCTGAGGG - Intronic
903838743 1:26223255-26223277 CATAGAGAATAAAGGGCGGACGG - Intergenic
904211838 1:28891014-28891036 CATAGAGAGAAAGGGGCAGAGGG + Intronic
904393014 1:30198099-30198121 GAGAGAGACAGAGGGGAGGAGGG + Intergenic
904563544 1:31413897-31413919 CAGAGAGACTGAGGGACGGACGG - Intronic
905316230 1:37083186-37083208 CAGAGACACAAAGAGGGGGAGGG + Intergenic
906333396 1:44907150-44907172 CAGAGAGACCAAGTAAGGGAAGG - Intronic
907275779 1:53315927-53315949 GGGAGAGACCAAGGGCCAGAGGG + Intronic
908695291 1:66833008-66833030 CAGAGTGGCCAAGGGGGGCAGGG + Intronic
909433399 1:75615338-75615360 CCTAGGGACGAAGGGGCGGAGGG + Intergenic
910758511 1:90714339-90714361 GAGAGAGACCAAAGGGCAGCTGG - Intronic
911183691 1:94883051-94883073 CAGAGAGGCCAGGGGTCAGAAGG + Intronic
912452053 1:109773284-109773306 CTGGGAGACCATGGGGAGGACGG + Intronic
912869650 1:113292329-113292351 TAGAGAGAGGAAAGGGCGGAGGG + Intergenic
913349016 1:117837578-117837600 CAGAGTGATCTAGGGGCAGAAGG - Intergenic
914932311 1:151946049-151946071 CAGAGACACCTTGGGGCTGAGGG + Intergenic
915580500 1:156809975-156809997 CAGGGAGACCCAGGGTTGGATGG + Intronic
918984260 1:191602669-191602691 AAGAGAGACCTAGGAGCTGATGG - Intergenic
919412654 1:197265434-197265456 CAGAGAGAGAAAGAGGAGGAGGG - Intergenic
919761469 1:201100656-201100678 CAGAGGGACAATGGGGCTGAGGG + Intronic
921805297 1:219447033-219447055 CAGAGAGAGACAGGGGCGGGTGG - Intergenic
923105501 1:230850736-230850758 CACAGAGACCAAGTTGCGGGTGG + Intronic
923298494 1:232618278-232618300 CCCAGAGACCTGGGGGCGGAAGG + Intergenic
1062890692 10:1057241-1057263 CAGAGGGACCAGGGTGCGGGAGG + Intronic
1063127735 10:3150269-3150291 CGGAGGGACCAAGGTGCGGAAGG + Intronic
1065288656 10:24208956-24208978 CGGACAGACCTAGGGACGGAGGG + Intronic
1065944399 10:30593699-30593721 CAGAGTGACCAAGGAGCAGGAGG - Intergenic
1065968686 10:30788800-30788822 AAGAGAGACCCATGGGCAGAGGG + Intergenic
1069745178 10:70710416-70710438 CAGACAGGCCTAGGGGCAGAGGG - Intronic
1070333348 10:75433190-75433212 CAGAGAGACCTAGGGTCTGGGGG - Intronic
1070400714 10:76051127-76051149 CAGAGCGACCAGACGGCGGAGGG - Intronic
1070440882 10:76441941-76441963 CAGAGAGACGAGGTGGCAGATGG - Intronic
1070557308 10:77538689-77538711 CAGAGGGACCAAGGTGGGGGAGG - Intronic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072288889 10:93943938-93943960 TAGAGAGACCAAGGGGGAGGTGG - Intronic
1072799936 10:98385748-98385770 CACAGAGGCCAGGGGGAGGAAGG - Intronic
1072929868 10:99652741-99652763 CAGAGAGACCAGGGTGAGGTAGG - Intergenic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1073845036 10:107544962-107544984 GAGGGAGGCCAAGGGGCTGAGGG + Intergenic
1076109137 10:127848178-127848200 GAGAGAGAGCAAGGGAGGGAGGG + Intergenic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1077320637 11:1939436-1939458 CAGAAAGACTCAGGGGCGGGCGG + Intergenic
1077478719 11:2803110-2803132 CAGAGTGAGCAAGGGGCTCAGGG + Intronic
1078830416 11:14972415-14972437 CACAGCAACCAATGGGCGGAGGG + Intronic
1079281739 11:19093496-19093518 CAAAGAGAACAGGGGGTGGAGGG - Intergenic
1079325334 11:19486329-19486351 CAGAAAGACCAAAGGCCTGAAGG - Intronic
1079339176 11:19597982-19598004 CAGAGAGACCACGGGGCAGCTGG + Intronic
1080068709 11:28052356-28052378 CAGAGAGATAAAGGGAAGGAAGG - Intronic
1080944035 11:36950951-36950973 AAGAGAAACTAAGGGGGGGAGGG + Intergenic
1082160320 11:48882676-48882698 CAGAGAGACCAGGGGGAGTCTGG - Intergenic
1082162046 11:48897730-48897752 CAGAGAGACCAGGGGGAGTCTGG + Intergenic
1082609431 11:55280403-55280425 CAGAGAGACCAAGGAGAGTCTGG - Intergenic
1082744966 11:56951208-56951230 CAGAAAGATCAAGGGGCAGCAGG + Intergenic
1082832331 11:57627992-57628014 GAGAGAGAGCAAGGGGAGAAAGG + Intergenic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083316068 11:61815740-61815762 CAGTGAGACCAAGGGAAGAAGGG + Intronic
1083424774 11:62577667-62577689 GAGAGAGGGCAAGGGGCGAAGGG + Intronic
1083781968 11:64923431-64923453 CAGGGACACCAAGGGCCGGATGG + Intronic
1084147383 11:67272258-67272280 CACAGAGGTCAAGGGGGGGATGG + Intronic
1084196329 11:67525109-67525131 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196346 11:67525151-67525173 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196363 11:67525194-67525216 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084958337 11:72703248-72703270 GAGAGAGGCCAAGGGGAGGAGGG + Intronic
1086199924 11:84189820-84189842 CAGAGAGGCCTATGGGGGGAAGG + Intronic
1089144634 11:116316582-116316604 CAGAGAGAGCGAGGGAGGGAGGG + Intergenic
1089641620 11:119851421-119851443 GAGAGAGAGCAAGGGAGGGAGGG - Intergenic
1091254518 11:134172167-134172189 CAGAGAGCGCAAGAGGCAGATGG - Intronic
1092254911 12:6921555-6921577 CAGAGAGAGCATGGTGGGGAGGG - Intronic
1092900434 12:13054725-13054747 CAGTGAGGCCAAGGGGTGGGTGG + Intronic
1093183084 12:15988843-15988865 GAGAAAGGCCAAGGGGCTGAGGG - Intronic
1094503089 12:31037514-31037536 CACAGAGACCAAGATGTGGAAGG - Intergenic
1095976827 12:47946074-47946096 GAGAGAGACCACGGGAGGGAGGG - Intergenic
1096619458 12:52853888-52853910 CACAGAAACCAAGAGGAGGAAGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1100014298 12:89990255-89990277 CTGAAAGACCAAGAGGTGGAAGG - Intergenic
1101529933 12:105564491-105564513 CACAGAAACCAAGGGTAGGATGG - Intergenic
1101830590 12:108253526-108253548 GAGAGAGAGAAAGGGGGGGAAGG - Intergenic
1102108938 12:110349409-110349431 CAGAGAGGCCAAGGGAGGCACGG - Intronic
1102500506 12:113349004-113349026 CAGAGGGAGCAAGGGAAGGAGGG - Intronic
1102535445 12:113577311-113577333 CAAAGAGACTAAGGGAGGGAGGG - Intergenic
1104773556 12:131379485-131379507 CTGAGAGACCAGGCGGCTGATGG - Intergenic
1104917011 12:132270913-132270935 CAGAGAGAGCAAGGAGGAGATGG + Intronic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1108517478 13:51216731-51216753 CAAAGAGACCAAGAGGGGAAGGG - Intergenic
1112561542 13:100519653-100519675 CTTAGAGACAAAGGGGAGGAGGG - Intronic
1113522868 13:110953094-110953116 CAGAGGGACCCAGGGCAGGAAGG - Intergenic
1115547281 14:34475449-34475471 GAGGGAGACCATGGGGCGGGGGG - Intergenic
1115935656 14:38549114-38549136 AAGAGAGAGGAAGGGGCTGATGG - Intergenic
1117356496 14:54928731-54928753 CAGAGAGAGAAAGGGATGGAGGG + Intergenic
1118164584 14:63323804-63323826 CAGAGAGAAGGAGGGACGGAGGG - Intergenic
1118708392 14:68500762-68500784 CAGAGAGACCATGTGGCAGGGGG - Intronic
1120037560 14:79715364-79715386 CAGAGAGACCCAGGTGGTGATGG + Intronic
1120433000 14:84443676-84443698 CAGAGAGAGAAAGGGGAGTAGGG + Intergenic
1121427366 14:93862052-93862074 CAGAGAGATTACGTGGCGGAGGG - Intergenic
1121954917 14:98204968-98204990 CAGAGAGACCAAGGCAGGCAAGG - Intergenic
1126181583 15:45790760-45790782 CAGACTGAACAAGGGGCAGATGG - Intergenic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1129252782 15:74318130-74318152 CAGAGAGACTAAGGGGGAGGGGG + Intronic
1129404298 15:75304693-75304715 CAGAGAGAGAAAGGGAGGGAGGG - Intergenic
1129739368 15:77982613-77982635 GAGGAAGACCAAGGGGCGGGGGG - Intergenic
1129768394 15:78185026-78185048 GAGGGAGAGAAAGGGGCGGAGGG + Intronic
1130384808 15:83401759-83401781 CAGAGAGAGCCAGGAGAGGAGGG + Intergenic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1131857722 15:96616578-96616600 CAGGGAGACCAAAGGCCGGGAGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1133392115 16:5419005-5419027 CAGAGAGAGCAAGGTGGGGAAGG + Intergenic
1133413082 16:5584527-5584549 CACAGAGACCAAGGGTAGGCTGG + Intergenic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1135420093 16:22299883-22299905 AAGAGAGACCGGGGGGCGGGGGG + Intronic
1136390839 16:29963221-29963243 CAGAGAGGCCAAGGAGCAGCAGG - Exonic
1137756062 16:50903356-50903378 CAGAGAGATGAAGGGACTGAGGG - Intergenic
1137825865 16:51494269-51494291 GAGAGAGAGCAAGGAGGGGAGGG - Intergenic
1140207832 16:72948050-72948072 CTGAGGGACCAAAGGGCTGAGGG + Intronic
1140783746 16:78319747-78319769 CAGAGAGACCTCGGTGCAGATGG - Intronic
1142232215 16:88905336-88905358 CAGAGGGAACGAGGGGCGGTGGG - Intronic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1143771676 17:9173132-9173154 CAGAGAGACCAGGGGAGGGGAGG - Intronic
1145143278 17:20461397-20461419 CAGAGAGACCAAGGTGGGGGTGG - Intronic
1145255592 17:21320524-21320546 CCAAGAGACCAAGGGGTTGAAGG + Intergenic
1145321021 17:21767425-21767447 CCAAGAGACCAAGGGGTTGAAGG - Intergenic
1146927356 17:36754236-36754258 CAGAGAGACCAGTGGAAGGAGGG + Intergenic
1147978259 17:44260068-44260090 CAGAGAGACCCTGGGATGGAAGG + Intronic
1148848195 17:50541272-50541294 CACAGAGACCAAGGAGGGGCTGG + Exonic
1148860867 17:50603781-50603803 CAGAGAGGGGAAGGGGCAGAGGG - Intronic
1150124944 17:62629423-62629445 CACAGAGACCAGGAGGAGGAGGG - Intronic
1150389018 17:64780360-64780382 CAGGGAGCCCAAGGGCCGGGTGG + Intergenic
1150790428 17:68197557-68197579 CAGGGAGCCCAAGGGCCGGGGGG - Intergenic
1151656155 17:75496981-75497003 CAGAGGGAACAGGGGCCGGAGGG - Intronic
1152234051 17:79129423-79129445 CCTAGAGACCCAGGGGAGGAAGG + Intronic
1153299885 18:3583220-3583242 CAGAGAGAGAAAGGGAGGGAGGG - Intronic
1154370628 18:13758929-13758951 CAGAGAGGCCAAGGAGAGGGAGG + Intronic
1159900997 18:74045494-74045516 CAGAGAGGCCAATGGGCAGCTGG - Intergenic
1161029714 19:2051945-2051967 GAAAGAGCCCAAGGGGTGGATGG + Intergenic
1161233402 19:3186578-3186600 CAGGAAGCCTAAGGGGCGGAGGG - Intronic
1161754237 19:6119833-6119855 GAGAGAGAGAAAGGGGTGGAAGG - Intronic
1161993265 19:7697359-7697381 CAAAGAGACCAAGGGATGGGTGG - Intronic
1163393143 19:17042742-17042764 GAGAGAGACAAAGGGAGGGACGG + Intergenic
1167103691 19:47418917-47418939 CTGGGAGACCCAGGGGCGGAGGG + Intronic
1167108263 19:47443689-47443711 CAGAGACACCAAGAGGCGTCAGG - Intronic
1167668502 19:50836611-50836633 CAGAGAGAGGCAGGGGCCGAAGG - Intronic
1167792775 19:51691449-51691471 GAGAGAGACAAAGAGGGGGAAGG + Intergenic
1168169372 19:54575716-54575738 CAGAGAGACTAAGGGTCCCAGGG + Intronic
1168687678 19:58358295-58358317 GAGAGAGGCCAAGGGTGGGAGGG + Intronic
924980062 2:211187-211209 CAGAGTGCCCGAGGGGCTGATGG - Intergenic
925043831 2:755682-755704 CAAAGAGATCAAGAGGAGGAGGG + Intergenic
925146953 2:1588167-1588189 CAGAGAGACAGAGGGACAGAGGG - Intergenic
925846924 2:8043048-8043070 CAGAGGGGCCATGGGGCGGGGGG + Intergenic
927697977 2:25250939-25250961 CTGAGAGACAAAGGGGCCGTGGG - Intronic
929544508 2:42847013-42847035 CAGAGAAACCAAGAGCCAGATGG - Intergenic
932206251 2:69885545-69885567 AACAGAGAGCAAGAGGCGGAGGG - Intergenic
932276332 2:70454753-70454775 CAGGGAGACCAAGGCTGGGAAGG + Intronic
933266616 2:80187700-80187722 CAGAGAGAAAGAGGGGCAGATGG + Intronic
934128185 2:88919814-88919836 CAGAGAGGCAGAGGGGCAGAGGG - Intergenic
934974017 2:98787718-98787740 CAGAGAGACCCAGGGGAGGGAGG - Intergenic
935112930 2:100108460-100108482 CAGAGAGCCCAAGGCGGAGATGG - Intronic
935245989 2:101219255-101219277 CAGAGAAACAAAGGGAGGGAGGG - Intronic
936151092 2:110022840-110022862 GAGGGAGACCAAGGGGCTGGCGG - Intergenic
936193585 2:110348529-110348551 GAGGGAGACCAAGGGGCTGGCGG + Intergenic
937892409 2:126948634-126948656 CAGTGAGATCAAGGGGGGAAAGG - Intergenic
939350633 2:141033231-141033253 CAGAGAGAGCAAGGGAGGGGAGG + Intronic
940558444 2:155263261-155263283 CAGAGAGATAAAGAGGAGGAAGG + Intergenic
942877849 2:180823894-180823916 CAGAAAGACCTAGGGGAAGATGG - Intergenic
943575172 2:189623865-189623887 AAGAGAGTCCAAGGGGCAAATGG - Intergenic
946066254 2:216989880-216989902 CAGAGAGACCATGGGAGGAAAGG + Intergenic
946294653 2:218774253-218774275 CAGAGAGAGAAAGGGAGGGAGGG + Intergenic
948778835 2:240304651-240304673 CAGAGACACCACGGGGCGAGAGG + Intergenic
1168924411 20:1567352-1567374 CAGAGAGGCAAAAGGCCGGAGGG - Intronic
1169448554 20:5692086-5692108 CAGTGAGGCCAAGGGGCCAAGGG + Intergenic
1169693922 20:8365480-8365502 AAGAGAGACCAGGTGGCAGACGG + Intronic
1170640769 20:18150689-18150711 CAGAGCGAACAAAGGACGGACGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172777175 20:37414549-37414571 CAGAGACAGCGAGGGGAGGAAGG - Intergenic
1174009633 20:47439192-47439214 CACAGACACCAAGGGGGAGAAGG - Intergenic
1174186244 20:48708310-48708332 CAATGAGACCAAGCGGCAGATGG - Exonic
1174532004 20:51221731-51221753 CAGAGGGAGCAAGGGGTGGGAGG + Intergenic
1175341015 20:58228814-58228836 CAGGGAGACCGATGGGCGGGCGG + Intergenic
1175520690 20:59600785-59600807 CAAGGAGATCAAGGGGCAGAAGG + Intronic
1175725879 20:61318026-61318048 CAGAGAGACTAAAGGGCTGGAGG + Intronic
1175897511 20:62345937-62345959 CTGAGAGACCAAGGGTGGCAGGG - Intronic
1175968362 20:62671285-62671307 CAGAGAGCCAGAGCGGCGGAAGG - Intronic
1176222352 20:63975654-63975676 CAGAGAGGCCTGGGGGCTGATGG - Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1179548027 21:42125251-42125273 CAGAAAGCCCCAGGGGCTGAGGG + Intronic
1180004598 21:45014524-45014546 GAGAGAAACCAAGTGGCAGAGGG + Intergenic
1180954771 22:19736764-19736786 CAGACAGACCGACGGACGGAGGG - Intergenic
1181038617 22:20181651-20181673 CAGAGAGCCCAAGGTGGGCATGG - Intergenic
1181450636 22:23017536-23017558 CAGAGCGACCAAGGGGTGGGAGG + Intergenic
1182007048 22:26969738-26969760 AAGAGAGACAAAGGGAAGGAGGG - Intergenic
1183146834 22:36000604-36000626 AAGAGAGACGAAGGGTGGGAAGG + Intronic
1183278145 22:36914243-36914265 CAGAGAGACTAAGAGGCAGAGGG + Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184232264 22:43164675-43164697 CAGACAGTCCAAGCAGCGGATGG + Intergenic
1184486604 22:44783559-44783581 GAGAGAGACCTAGGGGAGGTGGG - Intronic
1185062375 22:48613775-48613797 CAGAGTCACGAAGGGCCGGAAGG - Intronic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
950101584 3:10360127-10360149 CAGAGAGAGGAAGGAGCGGCTGG + Intronic
950427868 3:12934417-12934439 AAGAGAGAACAGGGGGCAGACGG + Intronic
952033262 3:29170201-29170223 GAGAGAGAGGAAGGGGGGGAAGG + Intergenic
953679250 3:45027213-45027235 AAGAGAGTCCAAGGGGATGAGGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
953793952 3:45968541-45968563 CAGAGAGAACCAGGAGCTGAGGG - Exonic
954595771 3:51822993-51823015 CAGTGAGTCCAAGAGGTGGAAGG - Intronic
956750069 3:72338022-72338044 CAGAGAGGCCATGGGGCTGACGG - Intergenic
956856490 3:73280212-73280234 AAGAGAGAACAAGGGCCGGCAGG + Intergenic
957942592 3:87023562-87023584 AAGAGAGTCCAAGGGGTGGTTGG - Intergenic
959648635 3:108730221-108730243 CAGGCAGACTAAGGGGCGGGGGG + Intergenic
960433041 3:117593388-117593410 CAGAGAGAGAAAGAGGCAGAGGG - Intergenic
960741696 3:120841108-120841130 TTGAGAGGCCAAGGGGCGGGGGG - Intergenic
961963820 3:130881373-130881395 GAGAGAGACAAAGGAGGGGAAGG - Intronic
963073421 3:141323993-141324015 CAGAGCTACCAAGAGGCAGATGG - Intergenic
963654266 3:148025222-148025244 GAGATAGACCAAAGGGAGGAGGG + Intergenic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
967960125 3:194913677-194913699 CAGAAAGACAGAGGGGAGGAGGG + Intergenic
968295939 3:197576792-197576814 CAGAGACCCCAGGGGGTGGAGGG - Intergenic
968648210 4:1750175-1750197 CAGAGAGAGGAGGGGGCGGGGGG + Intergenic
968904013 4:3443472-3443494 CAGAAGGGCCAAGGGGAGGATGG + Intronic
968945009 4:3658968-3658990 CAGAGAGACAAAGGAGAGGAGGG - Intergenic
969307567 4:6334652-6334674 CAGAGAGACCCAGGGAACGATGG + Intronic
970571978 4:17392369-17392391 CAGACAGACAAAGGGAAGGAAGG + Intergenic
971317081 4:25576581-25576603 CAGTGTGACAATGGGGCGGAAGG - Intergenic
972252871 4:37323072-37323094 CAAAGAAACCAAAGGGCAGAGGG - Intronic
973537757 4:51901144-51901166 CTGAGTGACCCAGGGGCTGAAGG - Intronic
974374779 4:61062144-61062166 CAGAGAGAGAGAGGGGAGGAAGG + Intergenic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
976830933 4:89312999-89313021 GAGAGAGAAGAAGGGGAGGAAGG - Intergenic
978659760 4:111110653-111110675 CAGAGAGGCAAAGTTGCGGAGGG + Intergenic
978811067 4:112850353-112850375 CAGAGAGATGAATGGGTGGATGG - Intronic
980749313 4:137068635-137068657 CATTGAGACCAAGGGGGGGTGGG - Intergenic
981417842 4:144513920-144513942 CAGAGAGAACAAGGAGGGAAGGG + Intergenic
982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG + Intergenic
986125986 5:4882717-4882739 CAGACAGACCCAGGGCTGGAGGG + Intergenic
988280092 5:29134262-29134284 CAGGGAGGGCAAGGGGGGGATGG + Intergenic
993526840 5:88975580-88975602 CAGGGAGGCCAAGAGGCGGGAGG + Intergenic
993904925 5:93612146-93612168 CCGTGGGACCAAGGGCCGGACGG + Intergenic
996532525 5:124541471-124541493 AAGAGAGACAAAGGGGCTGAGGG + Intergenic
997735637 5:136210670-136210692 GAGAGAGACCCAAGGGCAGATGG - Intergenic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1000184050 5:158841753-158841775 CTAAGAGACCAAGGAGCAGAGGG - Intronic
1000391359 5:160726630-160726652 CAGAGAGAGCAAGGGGGTGGGGG + Intronic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1003020120 6:2502512-2502534 AAGAGAGAGCAAGGGCAGGAGGG + Intergenic
1003915930 6:10786344-10786366 CTGAGAGACCAAGCAGGGGATGG + Intronic
1004559224 6:16731534-16731556 CAGAGCGACCAAGGGCTGCAAGG + Intronic
1006825278 6:36930230-36930252 CACAGAGGCCAAGGGAGGGAGGG - Intergenic
1007390157 6:41546259-41546281 GCGAGAGAGCAAGCGGCGGAGGG - Intergenic
1009285398 6:61810109-61810131 CTGAGAAACCAAGGTACGGATGG - Intronic
1010012199 6:71061201-71061223 CAGAGGCACCAAGGGGAGCAGGG - Intergenic
1010600806 6:77823838-77823860 CACAGAGACCCAGGGACAGATGG - Intronic
1011534419 6:88360678-88360700 CAGAGAGATGAAGAGGAGGATGG - Intergenic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1012487924 6:99742962-99742984 GAGAGAGAGAAAGGGACGGAGGG - Intergenic
1016183193 6:141171795-141171817 GAGAGAAAGCAAGGGGAGGAGGG + Intergenic
1017637317 6:156456101-156456123 GAGAGAGGACAAGGGGAGGAGGG - Intergenic
1018228907 6:161656720-161656742 GAGAGTGACCAAGGGGCCAAGGG - Intronic
1020011407 7:4807717-4807739 CAGAGAGACGGAGGGGGAGAAGG - Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022191179 7:28018164-28018186 CAGCGAGGCCAAGGGCAGGATGG + Intronic
1023055083 7:36284591-36284613 CAGAGAGACCGAGAGGCAGTAGG - Intronic
1023284835 7:38608304-38608326 CAGAGAGATAAAGGGCTGGATGG - Intronic
1027736193 7:81935900-81935922 CAGAGGGACAAAGGGACAGAAGG - Intergenic
1028134286 7:87210035-87210057 CAGAGAGACAGAGGAGGGGAAGG + Intronic
1029147756 7:98458763-98458785 CAGAGAGGCAAAGGCGAGGAGGG - Intergenic
1029192810 7:98783754-98783776 TGGAGAGACCAAGGGGCCGCAGG - Intergenic
1029548600 7:101224298-101224320 CAGGGACACAGAGGGGCGGACGG - Intergenic
1029604418 7:101590119-101590141 CAGATAGACCCAGGGGAGGCCGG - Intergenic
1030735533 7:113043495-113043517 CAGGGAGCCCAAGGGGAGGGAGG + Intergenic
1032401238 7:131625923-131625945 CAGAGAGACCCACGGGGGCAGGG - Intergenic
1035789256 8:2288886-2288908 GAGAGAGAGCAAGGTGCGGACGG - Intergenic
1035803549 8:2432819-2432841 GAGAGAGAGCAAGGTGCGGACGG + Intergenic
1036208392 8:6822101-6822123 CACAGAGACCAGGGGCTGGAAGG + Intronic
1036810903 8:11867355-11867377 CAGCGAAACCAAGAGGCGAATGG - Intronic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038488002 8:27950140-27950162 CAGAGCCACCAAGGAGGGGAAGG + Intronic
1038535483 8:28350068-28350090 GAGAGAGAGCAGGCGGCGGAGGG + Exonic
1039373724 8:37012769-37012791 GAGAGAGAGCAAGGGGCGAGGGG + Intergenic
1040312408 8:46243613-46243635 CAGAGAGACTCAGGGGCGCATGG + Intergenic
1040315837 8:46260472-46260494 AAAAGAGACAATGGGGCGGAGGG + Intergenic
1042101782 8:65282092-65282114 GAGAGAGACCAAGAGACAGAAGG - Intergenic
1044824531 8:96183657-96183679 CAGGGAGACCAAGGCGTGGCTGG - Intergenic
1045101592 8:98850109-98850131 CACAGAAACCAAAGTGCGGAAGG - Intronic
1045324652 8:101109223-101109245 CAGAGCAGCCTAGGGGCGGAGGG + Intergenic
1047490812 8:125373350-125373372 CAGAGAGAACAAGGGAGGGGAGG - Intergenic
1047586111 8:126274987-126275009 CAGAGAAACCATGTGGGGGAAGG + Intergenic
1049594480 8:143477108-143477130 CAGAGGGACCAAGGCCCGGAGGG - Intronic
1049642959 8:143723625-143723647 CAGAGAGGCCACGGGGCTGCAGG + Intergenic
1053056355 9:34995149-34995171 TAGAGAGGCCAAGTGGCAGACGG - Intronic
1054258441 9:62838423-62838445 CAGAGAGGCGCAGGCGCGGAGGG - Intergenic
1054732992 9:68720351-68720373 CAAAGAGACCATGGGGCGTGGGG - Intronic
1055360823 9:75488583-75488605 CAGAGAGTTCAATGGGTGGAAGG + Intergenic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1056482081 9:87015999-87016021 CAGAGAGGTCATGGGGTGGAGGG + Intergenic
1057026783 9:91740142-91740164 CAGAGAGAGCAAGGGATGTAAGG + Intronic
1057192871 9:93096998-93097020 CAGAGAGGCCCTGGGGAGGAAGG - Intronic
1057858926 9:98624538-98624560 CAGAGAGACTTAGGGTAGGAGGG + Intronic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058742641 9:107959204-107959226 CAGGTAGACCAAGGGGTGGCTGG - Intergenic
1059369838 9:113819715-113819737 CAGAGAAACAAAGGTGAGGATGG + Intergenic
1059430275 9:114245840-114245862 CAAAGAGACAAAGAGGAGGATGG - Intronic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1061408089 9:130403608-130403630 CAGAATGACCAAGGGACAGAAGG - Intronic
1061667741 9:132170136-132170158 AGGAGGGACCCAGGGGCGGACGG + Intronic
1062130725 9:134891727-134891749 CTGAGAGCCCAAGGGCAGGATGG - Intergenic
1062215057 9:135384603-135384625 CAGGGAGAGGCAGGGGCGGAAGG - Intergenic
1062430558 9:136525238-136525260 CAGAGAGAACAAGGGGAGCCAGG + Intronic
1186497654 X:10024687-10024709 GAGAGAGAGCATGGGGAGGAGGG + Intronic
1187959212 X:24552409-24552431 CAGAGAGTCCTAGTGGTGGATGG - Intergenic
1188862097 X:35270284-35270306 CTGAGAGCCCAAGGGGCTGCTGG + Intergenic
1189253530 X:39619954-39619976 CAGAGGGAACAAGGGGAGTAGGG + Intergenic
1190394346 X:49965155-49965177 CAGAGTAACAAAGGGGCTGAAGG + Intronic
1191936741 X:66435131-66435153 CAGAGAGACCAAAGAGAGCAAGG + Intergenic
1192167192 X:68833435-68833457 CAGAGAGCCCAAGGGAAGAAAGG - Intronic
1192180648 X:68913690-68913712 CAGAGAGGCCGAGGGGCAGAAGG + Intergenic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1196188602 X:112771610-112771632 CAGAGAGGCCAAGGAGCTGATGG + Intergenic
1196373924 X:115010547-115010569 GAGAGAGAAAAAGGGGAGGAAGG - Intronic
1197068710 X:122267143-122267165 CAGACACACCAAGGGCCAGAAGG - Intergenic
1197838756 X:130723028-130723050 CAGAGATCCCAAGGTGAGGATGG + Intronic
1199692656 X:150320457-150320479 CAGAAAGACCAAGGGATGGATGG - Intergenic
1199966204 X:152823316-152823338 CAGAGAGCCGGAGGGGAGGAAGG - Intergenic
1200042548 X:153380499-153380521 CAGAGAGCCCAGGGGACGCATGG - Intergenic
1201345625 Y:12981174-12981196 CAGAGAGACTAAGAAGCAGATGG + Intergenic