ID: 1133740694

View in Genome Browser
Species Human (GRCh38)
Location 16:8648872-8648894
Sequence CAGTAGTTTGAGAAGCTCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133740691_1133740694 -4 Left 1133740691 16:8648853-8648875 CCTGGGTGATTTGTGTGCACAGT 0: 1
1: 4
2: 32
3: 105
4: 375
Right 1133740694 16:8648872-8648894 CAGTAGTTTGAGAAGCTCTGGGG 0: 1
1: 0
2: 0
3: 23
4: 247
1133740690_1133740694 -3 Left 1133740690 16:8648852-8648874 CCCTGGGTGATTTGTGTGCACAG 0: 1
1: 4
2: 14
3: 56
4: 267
Right 1133740694 16:8648872-8648894 CAGTAGTTTGAGAAGCTCTGGGG 0: 1
1: 0
2: 0
3: 23
4: 247
1133740687_1133740694 19 Left 1133740687 16:8648830-8648852 CCGAATCTGCATCTCAACGAGAC 0: 1
1: 1
2: 0
3: 9
4: 68
Right 1133740694 16:8648872-8648894 CAGTAGTTTGAGAAGCTCTGGGG 0: 1
1: 0
2: 0
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133740694 Original CRISPR CAGTAGTTTGAGAAGCTCTG GGG Exonic
901749916 1:11399795-11399817 CAGTAGTTTGGGAAGCCAAGGGG - Intergenic
902537531 1:17129125-17129147 CAGCACTTTGGGAAGCTGTGTGG - Intergenic
903112926 1:21152624-21152646 AAGTATTTTGGGAAGCTCTCTGG - Intronic
903542458 1:24104754-24104776 CAGGAGTTTGAGAACATCTTGGG - Intronic
904407884 1:30305503-30305525 CTGTAGTTTGAGCAGCTCTTAGG - Intergenic
904658612 1:32068133-32068155 CTGTAGTTCCAGAAACTCTGGGG + Intergenic
905207149 1:36349493-36349515 CAGTTGTGTGTGCAGCTCTGGGG - Intronic
906682339 1:47737361-47737383 CAGTAGACTGTGATGCTCTGTGG + Intergenic
906920457 1:50058850-50058872 CAGCACTTTGGGAAGCTCAGGGG - Intronic
909292441 1:73900919-73900941 CAGTAGTATGCTAAGCACTGAGG + Intergenic
910304080 1:85741612-85741634 CAGTATGTTGAGAAGCTTGGTGG - Intronic
913224840 1:116689793-116689815 CAGTGGTAAGACAAGCTCTGGGG + Intergenic
913308466 1:117459194-117459216 CAGTCATTTTAGCAGCTCTGGGG - Intronic
913470913 1:119184821-119184843 CAGCACTTTGAGAAGCTGAGGGG - Intergenic
915016887 1:152742753-152742775 CAGTGCTATGAGAAGCTGTGGGG - Intronic
916133473 1:161631532-161631554 CAGGAGAGTGAGAAGTTCTGAGG - Intronic
917375164 1:174344378-174344400 AAGTAGTTGTAGAAGGTCTGCGG + Intronic
917556821 1:176099076-176099098 AAGTAGTTTGATTATCTCTGTGG - Intronic
918083322 1:181223989-181224011 CAGTAGAATCAGAAGCTTTGGGG + Intergenic
919001738 1:191840957-191840979 AAGTTGTTTGAAAAGCTATGTGG + Intergenic
922251337 1:223851364-223851386 CTGTAGTTTGCTAAGCTCTAGGG - Intergenic
924534952 1:244927605-244927627 CAGTGGTTTAAAAAGCACTGTGG - Intergenic
1064984265 10:21194218-21194240 CAGTACTTTGGGAAGCTGAGGGG - Intergenic
1065127476 10:22587548-22587570 CTGTGGTTTGAGATGCTCAGAGG - Intronic
1067223047 10:44357568-44357590 CAGTGGTTTTTAAAGCTCTGTGG - Intergenic
1067570901 10:47370165-47370187 CAGGAGGTGGAGAAGCTCAGAGG - Intronic
1069323927 10:67207502-67207524 CTGTAGCTTAAGAACCTCTGTGG + Intronic
1069894914 10:71674481-71674503 CAGCAGTTTGCCCAGCTCTGGGG + Intronic
1070011070 10:72475234-72475256 CAGTAGTTGGACGATCTCTGTGG + Exonic
1072771080 10:98138441-98138463 CAGCATTTTGAGATCCTCTGAGG + Intronic
1080928755 11:36785315-36785337 CAATCATATGAGAAGCTCTGTGG - Intergenic
1081012279 11:37828667-37828689 CAGTAGTTTGATACCCTCTTGGG + Intergenic
1081691614 11:45082057-45082079 CAGTGTCTTGAGAAGCACTGGGG + Intergenic
1082010353 11:47446286-47446308 CAGCACTTTGAGAAGCTGAGGGG - Intronic
1085170568 11:74446239-74446261 CAGGACTTTGAGAATCTCTATGG - Intergenic
1086423535 11:86661409-86661431 CAGTACTTTGACATGCTCTTTGG - Intronic
1088683500 11:112265463-112265485 CACTAGTCTGAGGAGCCCTGGGG + Intronic
1088961365 11:114669125-114669147 CAAAAATGTGAGAAGCTCTGTGG + Intergenic
1090427037 11:126615058-126615080 GAGTGATTTGAGATGCTCTGGGG + Intronic
1093008407 12:14077893-14077915 CAGTAGTTTGAAAAAGTGTGTGG - Intergenic
1093994684 12:25628964-25628986 AGGTGGTATGAGAAGCTCTGTGG + Intronic
1094143609 12:27206030-27206052 CAGTGGTTAGAGAAGCTGTGGGG - Intergenic
1095150005 12:38782886-38782908 CAGTAGTTTGAGAACAGCTTAGG - Intronic
1096830630 12:54311239-54311261 CAGTAGTTTGAGGTGCTACGTGG - Intronic
1097114815 12:56689327-56689349 CAGTACTTTGGGAAGTTCGGTGG + Intergenic
1097291084 12:57915666-57915688 CAGTAGTTTAAAAAACACTGTGG + Intergenic
1098287813 12:68926124-68926146 CAGGAGTTTGAGACCCGCTGGGG - Intronic
1098811913 12:75105390-75105412 CAGTAGGTTGTGTAGATCTGTGG + Intronic
1100259788 12:92922287-92922309 GAGTAGTTTGGGTAGCTGTGAGG - Intronic
1102423642 12:112823775-112823797 GAGTGGTTTGAGAATGTCTGAGG + Intronic
1102728625 12:115088656-115088678 CAGTGGATTCAGAATCTCTGGGG - Intergenic
1103643970 12:122376183-122376205 CAGTAGTTTGGGAGGCTAAGCGG - Intronic
1104351836 12:128050856-128050878 TAGTAAATTCAGAAGCTCTGCGG + Intergenic
1104500563 12:129281831-129281853 CGGTAGTTTGAGGAGGTTTGAGG - Intronic
1105622194 13:22079146-22079168 CACTGGTTTCAGGAGCTCTGAGG - Intergenic
1106538301 13:30667085-30667107 AAGAAGTGTGAGAAGCTCTGTGG + Intergenic
1107288993 13:38830671-38830693 CAGTAGGTTGGGAAGTTGTGTGG - Intronic
1107605976 13:42057503-42057525 CTGTAGTTTGTGAAGCACAGTGG + Intronic
1108290654 13:48957062-48957084 CAGGAGGTTGAAAAGCTATGGGG + Intergenic
1109220634 13:59637576-59637598 CAGTAGTCTGAAAAGTTCTGAGG - Intergenic
1109557409 13:63997661-63997683 TGGTAGTTTGAGTAGCTCTGTGG + Intergenic
1110602304 13:77388714-77388736 CAGAAGTATCAGAAGTTCTGGGG + Intergenic
1111685177 13:91492943-91492965 CAGTAGCAAGAGAAGCACTGGGG - Intronic
1111830781 13:93326197-93326219 AAGTAGTTTGAGAGGCTGTGGGG + Intronic
1112314425 13:98348838-98348860 CCGTAGTTTGCCAATCTCTGTGG + Intronic
1113915522 13:113869592-113869614 CAGCAGTTTGGGAAGCTAAGGGG - Intergenic
1114443307 14:22768245-22768267 AAGTAGTTGCAGAAGCTCTGGGG + Intronic
1114753168 14:25228661-25228683 CAGCAATTACAGAAGCTCTGAGG + Intergenic
1116132326 14:40871859-40871881 CAGAAATTTGATTAGCTCTGGGG - Intergenic
1119526072 14:75323449-75323471 CAGTAGGTGCAGAAGCCCTGAGG - Intergenic
1122464687 14:101923256-101923278 CTGTCCTTTCAGAAGCTCTGGGG + Intronic
1125569626 15:40706268-40706290 AAGTAGTTTGTCAAGCTCTTTGG - Intronic
1125746421 15:42000412-42000434 CTATAGATTGAGAATCTCTGGGG - Intronic
1125912105 15:43449927-43449949 CAATAGTTTGAGTAGATGTGTGG - Intronic
1128193107 15:65723374-65723396 AAGTATTTTGATAAGCTCTGTGG - Intronic
1129251366 15:74310933-74310955 AAGCACTTTGTGAAGCTCTGGGG + Intronic
1130140831 15:81225052-81225074 CTATAGAATGAGAAGCTCTGGGG + Intronic
1131838650 15:96414711-96414733 CAGTACTTTGAGCACCACTGTGG - Intergenic
1132065219 15:98725481-98725503 CAGGAGTTGGAGAAGCACTGTGG - Intronic
1132097958 15:99001963-99001985 CAGCACTTTGAGAAGCCCAGAGG - Intronic
1132102342 15:99033219-99033241 CAGTAGTTTGGGATCATCTGGGG + Intergenic
1133639330 16:7701640-7701662 CAGTATCTTGAGAAGCTTTGAGG + Intronic
1133740694 16:8648872-8648894 CAGTAGTTTGAGAAGCTCTGGGG + Exonic
1133740819 16:8649846-8649868 TACTAGTTTGAGAAGCTTTGGGG - Intergenic
1134387086 16:13783541-13783563 CAATATTGTGAGAAGCTGTGTGG - Intergenic
1135107601 16:19664023-19664045 GAGTAGTTTCAAAAGGTCTGTGG - Intronic
1135343943 16:21671882-21671904 CAGTACTTTGGGAAGCTCGAAGG + Intergenic
1136369021 16:29824349-29824371 CAGTAGATTCAGTGGCTCTGGGG + Intronic
1137784324 16:51125421-51125443 CAGGAATTTGAGAGGCTATGTGG + Intergenic
1140082756 16:71765090-71765112 CAGTACTTTGAGAGGCTGAGGGG + Intronic
1140812389 16:78590964-78590986 CATTTGGTTGAGATGCTCTGGGG + Intronic
1141108780 16:81255029-81255051 CAGCAGTTTGAGAGGCCCAGAGG - Intronic
1142177358 16:88651256-88651278 CTGAAGTTTGGGAAGCCCTGGGG - Intergenic
1143562918 17:7705760-7705782 CAGTGGGTAGGGAAGCTCTGGGG + Intronic
1144577540 17:16438542-16438564 CAGGGGTTTGAGAAGCCCCGTGG + Intergenic
1147691163 17:42315646-42315668 TAGTAGTTTCAGATGATCTGGGG + Exonic
1151411076 17:73930119-73930141 CATCAGTTTGGGAAGCTCTTTGG + Intergenic
1152205492 17:78972413-78972435 CAGCAGTTGGAGCAGGTCTGTGG + Exonic
1153640766 18:7155150-7155172 CTTGTGTTTGAGAAGCTCTGTGG + Intergenic
1155860130 18:30887437-30887459 CAGTAAATTTAGAGGCTCTGTGG - Intergenic
1156201836 18:34842099-34842121 CAGGAATTTGACAAGCTTTGGGG - Intronic
1156880559 18:42072742-42072764 CAGGAGTTTGAGAACCGCTTGGG - Intronic
1157429348 18:47611877-47611899 CTGCAGTTTGAGAAACACTGTGG - Intergenic
1157975630 18:52323925-52323947 CAGGGGTCTGAGAAGCTCTTGGG - Intergenic
1159012349 18:63069855-63069877 CAGCACTGTGTGAAGCTCTGTGG + Intergenic
1162552895 19:11367703-11367725 CAGAAGGTGGAGAAGCTCTCTGG + Intergenic
1162763112 19:12900228-12900250 CTGTTGTATGAGCAGCTCTGTGG - Intronic
1163429703 19:17259923-17259945 CAGTGGTTCTAGCAGCTCTGAGG - Exonic
1163483661 19:17573766-17573788 CAGTAGTTTGAGAATATCGTGGG + Intronic
1164931422 19:32178977-32178999 GAGGAGTTTGAGCAGTTCTGTGG - Intergenic
1167151086 19:47710210-47710232 CAACAGGTTGAGAAGCCCTGGGG + Intergenic
1168544907 19:57242239-57242261 CAGTTGGCTGAGAAGCCCTGAGG + Intronic
924969054 2:107547-107569 CAGCACTTTGAGAAGCTGAGGGG - Intergenic
925825339 2:7842902-7842924 CAGTATTTTGAGAAACGTTGTGG - Intergenic
926519776 2:13896703-13896725 GAATAGTTTGAAAAGCTCAGAGG + Intergenic
927627904 2:24742879-24742901 GAGTAGTCTGAGATACTCTGTGG - Intronic
927681926 2:25145360-25145382 CAGGAGTTTGAGATGATCTGGGG + Intronic
929063497 2:37948219-37948241 CTGCATTTTAAGAAGCTCTGTGG + Intronic
929132600 2:38593048-38593070 CAGTAGCGTGAGTAGTTCTGTGG - Intronic
929470841 2:42191400-42191422 CACTAGTTTGAGAAATTCTAAGG + Intronic
932292564 2:70594845-70594867 CAGCAGGGTTAGAAGCTCTGTGG - Intergenic
933416681 2:81995468-81995490 TAGTACTTTGACATGCTCTGAGG + Intergenic
934838396 2:97609854-97609876 CAGCAGTTTGAGAGGCTGAGTGG + Intergenic
937372569 2:121310893-121310915 CAGCAGTTTGAGAAGCTGAGGGG + Intergenic
938222145 2:129578917-129578939 CTGTAGTATTAGAAGCTCTTTGG + Intergenic
938610695 2:132944934-132944956 CAGGAGTTAGAGAGGCTCTTTGG + Intronic
939287913 2:140156492-140156514 CATTCCTTTGAGAAGCTCTAGGG + Intergenic
941443544 2:165569724-165569746 GTGTAATTTGAGAATCTCTGGGG + Intronic
941875514 2:170428811-170428833 GAGGAGTTTGAGAAGATCAGTGG - Intronic
943353345 2:186821362-186821384 CAGAACTTTGAGAAGCACTGGGG + Intergenic
943788705 2:191908013-191908035 CAGTAGATAGAGAACCTCTATGG - Intergenic
943908291 2:193529325-193529347 CAGTACTTTGGGAAGCTGAGGGG - Intergenic
946568426 2:220994035-220994057 CAGTATTTTTAGAAGCTCCCTGG + Intergenic
948671590 2:239571960-239571982 TAATAGTTTGAGAAGCACTTGGG - Intergenic
949027418 2:241773086-241773108 CAGGAGTTTGAGAAGAGCTTGGG + Intergenic
1169803261 20:9532969-9532991 CATTATTTTGAGAATCTCTGTGG + Intergenic
1170524436 20:17224397-17224419 CAATAGTTTGAGAAATGCTGAGG - Intergenic
1170607576 20:17885401-17885423 CAATATTTTTAAAAGCTCTGTGG - Intergenic
1171061813 20:21971731-21971753 AAGTAGTTGGTGAGGCTCTGTGG + Intergenic
1173078437 20:39843331-39843353 TAGTAGTCTGAGATGCACTGAGG + Intergenic
1173709961 20:45146437-45146459 TAGCAGTGTGAGGAGCTCTGTGG + Intergenic
1176362922 21:6013282-6013304 CACTGGTTGGAGAAGTTCTGAGG - Intergenic
1177052168 21:16249997-16250019 CAGTACTTTGAGAGGCTGAGGGG - Intergenic
1177057757 21:16329691-16329713 AGTTAGTTTGAGAAGCACTGGGG + Intergenic
1178314296 21:31556376-31556398 CAGTGGTTGGAGAAGCCCTCAGG - Intronic
1178390543 21:32194409-32194431 CAGTACTTTGGGAAGCTGAGTGG + Intergenic
1179679689 21:43010475-43010497 CAGGAGTTTGAGACCATCTGGGG - Intronic
1179760596 21:43525263-43525285 CACTGGTTGGAGAAGTTCTGAGG + Intergenic
1179852700 21:44146564-44146586 CAGGAGGCTGAGAGGCTCTGGGG - Intergenic
1180723194 22:17924763-17924785 CTGTGGCTTGAGATGCTCTGGGG - Intronic
1183551337 22:38487952-38487974 CAGCACTTTGATAAGCTCTCTGG + Exonic
1183982551 22:41550220-41550242 CAATAGGTAGAGAAGCTCTGTGG - Intergenic
1184168236 22:42743291-42743313 CAGGAGATTGAAAAGCTGTGAGG + Intergenic
949729912 3:7096818-7096840 CAGTGGTTTTTGAAGCTCTATGG + Intronic
949996442 3:9620909-9620931 CAGTAGTTTGGGAGGCTGAGGGG + Intergenic
951391639 3:22111433-22111455 CAGTAGTTTGCCAATCCCTGTGG - Intronic
952126140 3:30302968-30302990 CAGGAGTTTGAGATGAGCTGAGG - Intergenic
952417419 3:33101937-33101959 AAATAGTTTGAGAAGCACAGAGG + Intergenic
954582144 3:51708689-51708711 AAGTAGGTTGAGAAGCTCCTGGG - Intronic
955516654 3:59732584-59732606 CAGTTAGCTGAGAAGCTCTGGGG - Intergenic
956236079 3:67072445-67072467 CTGTAGTTTGAGAAGCACCGAGG - Intergenic
957494242 3:80969838-80969860 CAGGAGTTTGAGAGGCTCTCTGG - Intergenic
959596413 3:108133709-108133731 CACTTGTTTAATAAGCTCTGTGG + Intergenic
960850975 3:122053586-122053608 CAGGAGTTTGAGAACATCTTGGG - Intergenic
961191974 3:124969616-124969638 CAGTGCTTTGGGAAGCTGTGTGG - Exonic
962154071 3:132925823-132925845 CAGGAGTTTGAGAACCACAGTGG + Intergenic
962998652 3:140655847-140655869 CAGTGGGTTGCAAAGCTCTGTGG - Intergenic
963079105 3:141374949-141374971 CAGTGGTATTGGAAGCTCTGAGG + Intronic
963801834 3:149683876-149683898 CTGTAGTTTGAGTGGCACTGTGG + Intronic
964242755 3:154616012-154616034 CAGTGGTTTGACCAGCTCTAGGG - Intergenic
964966019 3:162494985-162495007 CATCAGTTTGAGGATCTCTGAGG + Intergenic
966089551 3:176116332-176116354 CAGCACTTTGAGAAGCTGAGGGG - Intergenic
966693299 3:182763042-182763064 CAGTAGTTTTGGATGCTGTGGGG - Intergenic
967093318 3:186153854-186153876 CAGCACTTTGAGAAGCCCAGAGG + Intronic
968381204 4:97978-98000 AAGAAGTTTGATAATCTCTGTGG - Intergenic
969153116 4:5187122-5187144 CAGTAGTCAGAGAAGCCATGGGG + Intronic
969351688 4:6601741-6601763 CAATGGTTTTAGGAGCTCTGTGG + Intronic
970739304 4:19215051-19215073 CAGTAGCTGGATAAGCTCTTGGG + Intergenic
970881593 4:20938633-20938655 GAGAAGTTTGTGAAGCTGTGAGG - Intronic
970972994 4:22006466-22006488 CACTAGTTTTAGAAACACTGTGG - Intergenic
971422757 4:26489159-26489181 CAGAGGTTTGGGAAGGTCTGGGG + Intronic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
972661184 4:41117956-41117978 CAGCACTTTGAGAAGCTAAGTGG + Intronic
973016391 4:45144101-45144123 TAGTAGTTTGATAAGAGCTGAGG + Intergenic
973658468 4:53076634-53076656 CAGTAATTTTAAAAGCTGTGAGG + Intronic
974475357 4:62372215-62372237 CAGTAGTTTTAGAAACTCATGGG - Intergenic
975784121 4:77869298-77869320 CAGTAGTTCAGGAAGTTCTGAGG + Intronic
976440270 4:85065138-85065160 GATTAGTTTGAGAAGCACTAGGG + Intergenic
978603461 4:110452662-110452684 CAGTACTTTGAGCTGCTGTGTGG + Intronic
982960451 4:161828497-161828519 CAGTAGTCTGATAAGTTCTTTGG + Intronic
984638922 4:182142949-182142971 CAGCAGTTTCGGAAGCTCCGGGG + Intergenic
985312561 4:188617887-188617909 CAGAAGCTTGAGCAGCTGTGAGG - Intergenic
985697167 5:1347124-1347146 CAGGAGTTTGAGGAGTTCTGCGG - Intergenic
985849086 5:2375348-2375370 CCGTGGTTGGAGAAGCTCTTGGG + Intergenic
987553745 5:19418005-19418027 CAGTACTTTGGGAAGCCCAGCGG + Intergenic
988111349 5:26826074-26826096 CTGTAGTTTGAGAATTTCTTTGG - Intergenic
989058332 5:37385757-37385779 CAAGGGTTTCAGAAGCTCTGTGG + Intronic
990057464 5:51601615-51601637 CATAAGCTTGAGAAGCTCTAAGG + Intergenic
992272222 5:75076808-75076830 CAAGAGTTTTAGAAGCACTGTGG + Intronic
994599152 5:101879983-101880005 CATAAGGTTGAGAAGTTCTGAGG + Intergenic
995304143 5:110623690-110623712 CAGTAATTTTAGCAGCACTGTGG + Intronic
996591470 5:125152797-125152819 CAGTAGGGTGAGGAGCCCTGGGG + Intergenic
1000374773 5:160569170-160569192 AATTATTTTGAGAAGCTCTATGG - Intronic
1000827142 5:166058931-166058953 CAGTAATTTGTGAAGATGTGTGG - Intergenic
1000890284 5:166793609-166793631 CTGTAGTTTGAAAAACACTGTGG - Intergenic
1002597104 5:180331135-180331157 CTGAAGTTTGAAAGGCTCTGTGG - Intronic
1004921266 6:20378319-20378341 CAGTACTTTGAGAGGGGCTGAGG + Intergenic
1004954688 6:20716365-20716387 CAGAAGTTTGTGAAGAGCTGGGG + Intronic
1007744034 6:44031231-44031253 CAGGGGGTTGAGAAGCCCTGGGG - Intergenic
1007952232 6:45882550-45882572 CAGTGGAATGAGAAGATCTGTGG + Intergenic
1008078070 6:47166770-47166792 CAGCACTTTGAGAAGCTAGGCGG - Intergenic
1010842629 6:80665178-80665200 CATTAATTTGTGAAGCTTTGAGG - Intergenic
1013400145 6:109786197-109786219 CAGCACTGTGATAAGCTCTGTGG - Intronic
1013703586 6:112804912-112804934 TAGGATTTTGAGAAGCTCTTTGG + Intergenic
1017332365 6:153214706-153214728 CAGTGTTGTGAGAAGGTCTGGGG - Intergenic
1017497577 6:154995386-154995408 GAGGAGTTGGAGAAGTTCTGGGG - Intronic
1018038015 6:159898380-159898402 AACCAGTTTGAGAAGCCCTGTGG - Intergenic
1019841396 7:3449796-3449818 CAGCATTTTGTGAGGCTCTGGGG + Intronic
1022085028 7:27058304-27058326 CAGGAGTTTGAGAACATCTTGGG - Intergenic
1023145401 7:37146086-37146108 CAGTTCAATGAGAAGCTCTGTGG + Intronic
1026886675 7:73953329-73953351 CAGTACTTTGAGAGGCTGAGGGG + Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028420601 7:90628473-90628495 CTGAAGTTTGAGAAGGACTGTGG - Intronic
1030291443 7:107876764-107876786 CAGTACTTTGGGAAGCTGAGGGG - Intergenic
1030572172 7:111240955-111240977 CTGTAGTTTTAGATGCTCTGTGG - Intronic
1031111180 7:117610637-117610659 CAGTTGTTTGAGTTGCTGTGAGG - Exonic
1031212694 7:118850887-118850909 CATTATTTTGTGAAACTCTGAGG - Intergenic
1031325350 7:120389858-120389880 CAGAAATTTGAGAATGTCTGGGG - Intronic
1032879647 7:136075617-136075639 CAGTCATTTGTGATGCTCTGTGG - Intergenic
1032968371 7:137130007-137130029 AAGTAGTTTGAGCAGTGCTGTGG + Intergenic
1033285822 7:140039871-140039893 GAGCAGTTTGAGAATGTCTGGGG - Intronic
1035015606 7:155763226-155763248 CAGTATTTTGTGATGCTCTTCGG + Intronic
1035955530 8:4074587-4074609 CAGTAGTTTGAAATGATTTGTGG - Intronic
1036703013 8:11025757-11025779 GAGTAATTAGTGAAGCTCTGGGG + Intronic
1036772697 8:11590012-11590034 TAGTAGATGGAGAGGCTCTGAGG + Intergenic
1037827369 8:22167442-22167464 CAGCAGGCTGAGAAGGTCTGGGG + Intronic
1037983016 8:23268639-23268661 CAGTACTTTGAGAGGCTGAGGGG - Intergenic
1040018772 8:42721810-42721832 CAGTGGTCTCAGAAGCCCTGTGG + Intronic
1042029781 8:64463491-64463513 CAGGAGTTTGAGAACAGCTGAGG + Intergenic
1043389746 8:79781045-79781067 CAGTAGTTTTTGAAGTTCTCAGG + Intergenic
1043449172 8:80349546-80349568 CAGTAGTTTGAGAACCTTCTGGG - Intergenic
1043872555 8:85450318-85450340 CAGCACTTTGAGAAGCTGTGAGG - Intergenic
1043889243 8:85638181-85638203 CATTAGTTTGAAAAGCCCTAGGG + Intergenic
1045096775 8:98806161-98806183 CAGTAGTGTGTGAGGTTCTGTGG - Intronic
1045760963 8:105607088-105607110 AAATAATTTGAGAAGATCTGAGG - Intronic
1047621261 8:126610703-126610725 CAGGAGTTTGAGAACAGCTGGGG - Intergenic
1051027550 9:12631061-12631083 AAGTAGTCAGAGAAGCTGTGGGG + Intergenic
1055368177 9:75568386-75568408 CAGTGGTTTAAGAACCACTGAGG - Intergenic
1056993544 9:91432737-91432759 CATTAGTGTGAGAAGGTCTTAGG + Intergenic
1058361553 9:104152867-104152889 CTGCAGTTTGAGGACCTCTGGGG - Intergenic
1058426604 9:104880781-104880803 CAGTAGTGTGCAGAGCTCTGAGG - Intronic
1058851542 9:109016114-109016136 TAGTCCTTTGAGATGCTCTGAGG + Exonic
1059206479 9:112471737-112471759 CAGTGGTTTGAGAGGCTGGGAGG + Exonic
1059386737 9:113970596-113970618 CAGCAGTTGCAGAAGCTCTCAGG - Intronic
1060834054 9:126741644-126741666 CAGTAGTTTGAGTGGCTGAGAGG - Intergenic
1187143840 X:16619824-16619846 GATTAGTTTGAGAACCTCTTTGG - Intronic
1187204487 X:17169375-17169397 CAGTAGGTAAAGAAGCACTGTGG + Intergenic
1187406788 X:19011589-19011611 CAGCACTTTGGGAGGCTCTGAGG + Intronic
1187767062 X:22654263-22654285 CAGTAGTTTGGGGACCCCTGGGG + Intergenic
1187927834 X:24266286-24266308 CAGTAATTTCAGTGGCTCTGAGG + Intergenic
1189712121 X:43824261-43824283 CACTTGTATGAGAAGCTCTATGG + Intronic
1191004291 X:55694474-55694496 CAATAGATTCAGAAACTCTGGGG + Intergenic
1195353646 X:104017853-104017875 TATTAGCTTGAGAAGCTTTGGGG + Intergenic
1196041176 X:111206020-111206042 CAGTATTTTGAGAAGTTTTGTGG + Intronic
1196179267 X:112672216-112672238 CAGAACTTTGAGAAGCTTTTTGG - Intronic
1196523390 X:116701143-116701165 CAGTTATTTCAGAAGCTCAGTGG - Intergenic
1197305889 X:124841733-124841755 CAGTGGTTTGAGAGCATCTGAGG - Intronic
1198840890 X:140856689-140856711 GAGTAGATTGAGAAGCTATGAGG - Intergenic
1199299169 X:146193054-146193076 AGGAAGTTTGAGAAGCTCTCTGG + Intergenic
1201489146 Y:14523298-14523320 CAGCTGTTTGAACAGCTCTGGGG + Intronic
1201516807 Y:14826657-14826679 CAGCAGTTTGGGAAGCTGAGTGG + Intronic