ID: 1133744675

View in Genome Browser
Species Human (GRCh38)
Location 16:8676986-8677008
Sequence CAACAACCAATCCTTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133744675_1133744677 -4 Left 1133744675 16:8676986-8677008 CCCAGCTAAAGGATTGGTTGTTG 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1133744677 16:8677005-8677027 GTTGTGCCCCAACTTTGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 94
1133744675_1133744684 25 Left 1133744675 16:8676986-8677008 CCCAGCTAAAGGATTGGTTGTTG 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1133744684 16:8677034-8677056 TCAAAGCATGAGGAGGACCACGG 0: 1
1: 0
2: 2
3: 14
4: 211
1133744675_1133744683 18 Left 1133744675 16:8676986-8677008 CCCAGCTAAAGGATTGGTTGTTG 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1133744683 16:8677027-8677049 GCGAAGTTCAAAGCATGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 109
1133744675_1133744682 15 Left 1133744675 16:8676986-8677008 CCCAGCTAAAGGATTGGTTGTTG 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1133744682 16:8677024-8677046 AAGGCGAAGTTCAAAGCATGAGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133744675 Original CRISPR CAACAACCAATCCTTTAGCT GGG (reversed) Intronic
903326407 1:22571318-22571340 CCACAACCAATCCTTGAGGTGGG + Intronic
906646606 1:47479667-47479689 CAACAACCAATCCATAAGGTGGG + Intergenic
907185904 1:52608923-52608945 CAACAACTAAACCTTTGGCCTGG - Exonic
910851509 1:91653858-91653880 AAGCAACCAATCCTTTAGGAGGG - Intergenic
910905262 1:92170361-92170383 CCAGAACCATTCCTTTATCTGGG - Intronic
911149242 1:94581161-94581183 CAACAACAAATCCTGGAGATGGG - Intergenic
912834062 1:112979879-112979901 CAATAACCCATACTTTAGCCAGG - Intergenic
916618043 1:166465469-166465491 CAAAAACCAATCCTTTGGCTAGG + Intergenic
918486907 1:185038877-185038899 CTTCAACCCAGCCTTTAGCTTGG - Intergenic
922230320 1:223680125-223680147 CAGCAACCAGTCCCTTAGCTTGG - Intergenic
923826450 1:237505820-237505842 AAACAACCAGTCCCTTACCTTGG + Intronic
1065240628 10:23700239-23700261 CATTAACCAATCCTGCAGCTAGG + Intronic
1065359977 10:24880405-24880427 CAACAACAAAAAATTTAGCTGGG - Intronic
1065907042 10:30264997-30265019 CAAAAAGCTATCCTTGAGCTTGG - Intergenic
1074701746 10:116098390-116098412 GAAAAACGAATCCTTTAGCCAGG - Intronic
1074744067 10:116513845-116513867 GAAAATCCAATCCTTTAACTGGG + Intergenic
1075804778 10:125178799-125178821 CAATATCCAATCCTGTGGCTGGG + Intergenic
1084304103 11:68270647-68270669 CAAAGACCAATCCTGAAGCTTGG + Intronic
1084354679 11:68629938-68629960 CAAGAACTGATCGTTTAGCTAGG - Intergenic
1084885415 11:72202569-72202591 CTCCAACCAATCTTTTAGATTGG - Intergenic
1087642012 11:100765125-100765147 CAATAACCAGTACCTTAGCTTGG + Intronic
1088503229 11:110505422-110505444 CAAAAACTAATCCTTTTGTTTGG + Intergenic
1089628526 11:119768616-119768638 CAAAAATCAATCATTTAACTGGG - Intergenic
1096874705 12:54618417-54618439 ATACAACCAATCCTTTAAATAGG - Intergenic
1096954531 12:55512337-55512359 CAACACCCAATCTTATGGCTTGG + Intergenic
1097227023 12:57483344-57483366 CAACTACCACTCCTTTAGCCTGG + Intronic
1099016006 12:77345127-77345149 CAACAACCTAGCATATAGCTGGG + Intergenic
1099213593 12:79825010-79825032 CAACAACGAATAATGTAGCTGGG + Intronic
1102727006 12:115074631-115074653 CAAGGTCCAGTCCTTTAGCTGGG - Intergenic
1107790597 13:43998407-43998429 CCACATCCAACCCTTTATCTGGG - Intergenic
1108458872 13:50644951-50644973 CCACCACTATTCCTTTAGCTTGG + Intronic
1111715432 13:91873840-91873862 CAAAAAACAAACATTTAGCTGGG - Intronic
1112766169 13:102746472-102746494 CAGGTACCAATCCTTTAGTTTGG + Exonic
1115862146 14:37699529-37699551 CAACAACCAATCAATTTGCTGGG + Intronic
1119234724 14:73009944-73009966 CAAAAATCAATCAGTTAGCTGGG + Intronic
1131706190 15:94999094-94999116 CAACAACCAACCAGTGAGCTTGG + Intergenic
1133744675 16:8676986-8677008 CAACAACCAATCCTTTAGCTGGG - Intronic
1141576259 16:84965250-84965272 CAACAGTCAAACCCTTAGCTCGG - Intergenic
1143435410 17:6920899-6920921 CAAGAAGCATTCTTTTAGCTGGG - Intronic
1144066697 17:11630611-11630633 CAACTACCAATCCGTCATCTAGG - Intronic
1145011283 17:19369714-19369736 CAACAAATAATTCTTTAGTTAGG - Intronic
1147910729 17:43854421-43854443 CAAGAACCAATCCTTCAGGCTGG - Intronic
1148247458 17:46043421-46043443 CAAGAACAAATCATTCAGCTGGG + Intronic
1150903141 17:69305572-69305594 TAAAAACCAATCCTTTGGCCAGG + Intronic
1156189018 18:34697184-34697206 CCACCACCATTCCTTTAGGTGGG + Intronic
1162834181 19:13305337-13305359 CAACACCTAATCCTTTGCCTTGG - Intronic
1166388284 19:42394494-42394516 CAACAACCCATCTTATAGGTGGG - Intergenic
927130320 2:20053003-20053025 CCACACCCCATCCTTTAGCGTGG - Intergenic
927810587 2:26178421-26178443 CAACAACAAATAAATTAGCTAGG + Intronic
927970590 2:27303915-27303937 CAAAAACCAACCATGTAGCTGGG + Intronic
935599525 2:104908760-104908782 TAAGAATCAATCCTTAAGCTAGG + Intergenic
936785615 2:116090569-116090591 CAACAACAAAAACATTAGCTGGG - Intergenic
941764239 2:169279066-169279088 CAAAATCCAATCTCTTAGCTAGG + Intronic
944096629 2:195975583-195975605 GCACAACCACTTCTTTAGCTAGG - Intronic
945544816 2:211137775-211137797 CAACAACTTATCCTTCACCTTGG - Intergenic
946829061 2:223709113-223709135 GAACAACCATTCCTTTTTCTGGG + Intergenic
947760915 2:232603230-232603252 CAAAAACCAATCAATTGGCTGGG + Intergenic
1170414837 20:16128610-16128632 CAACAATCATTTATTTAGCTCGG + Intergenic
1171213838 20:23337344-23337366 CAGCACCCCATCCTTTATCTGGG + Intergenic
1174061629 20:47837013-47837035 CAAAAACAAAACATTTAGCTGGG - Intergenic
1174069880 20:47892211-47892233 CAAAAACAAAACATTTAGCTGGG + Intergenic
1174069890 20:47892305-47892327 CAAAAACAAAACATTTAGCTGGG + Intergenic
1177401551 21:20612057-20612079 CAAAAACCAATTCTCTACCTGGG - Intergenic
1183436022 22:37795725-37795747 CCACAGCCAACCCTTTAGCAAGG + Intergenic
952051080 3:29385343-29385365 CCACAACCAATCCCTTCCCTTGG + Intronic
952789029 3:37184189-37184211 CAACAACCATTCATTTAGTTTGG - Intergenic
967063962 3:185897746-185897768 CAACAACAAAACCATTAGCTGGG + Intergenic
967186381 3:186948194-186948216 CAACATTCATTCCTGTAGCTTGG - Intronic
973158976 4:46993051-46993073 CAACCTCCTCTCCTTTAGCTTGG - Intronic
974268227 4:59614592-59614614 CAAAAACCAAACATTTAGCTGGG + Intergenic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
977204665 4:94155299-94155321 CAACAACTTATCCTTCACCTTGG - Intergenic
977448247 4:97159670-97159692 CAAAAAGCAATTCATTAGCTTGG - Intergenic
979049560 4:115912250-115912272 AAACAACAAATCCTTTATCTTGG - Intergenic
979426426 4:120572664-120572686 CAACAACCCAACCTGTACCTTGG + Intergenic
981159012 4:141474613-141474635 CAGCAACCACTGCTTTAGCCGGG - Intergenic
982016825 4:151162868-151162890 CAAAGACCAATCCTGTGGCTGGG - Intronic
982835760 4:160118221-160118243 CAACAACCATTCCATTATCCTGG + Intergenic
984107340 4:175564712-175564734 TTACAACCAATCCATCAGCTAGG + Intergenic
985798540 5:1984734-1984756 CAATAAATAATCCTTTAGCCAGG + Intergenic
991489598 5:67169761-67169783 CAACATTAAGTCCTTTAGCTGGG + Intergenic
992566577 5:78000856-78000878 AAAAAACCAAACCTTTAACTTGG + Exonic
994074723 5:95637587-95637609 AAACAAACAAACCTTTAGCCTGG + Intergenic
996562902 5:124850126-124850148 CCACCACCAATTCTTTAGATTGG - Intergenic
1002805909 6:573596-573618 CAACAGCAAATCCTTTTGCTTGG - Intronic
1004712893 6:18189221-18189243 CAACAACAAAACCTTAAGATAGG - Intronic
1005344271 6:24874020-24874042 CAACAACAAACTATTTAGCTGGG - Intronic
1008003929 6:46389789-46389811 CAACAGCCATGCCTTTAGTTAGG + Intronic
1010485657 6:76410225-76410247 CAATTAACAAACCTTTAGCTAGG - Intergenic
1012363028 6:98407011-98407033 CAACAACTTATTCTTTACCTTGG + Intergenic
1013571667 6:111433284-111433306 TAACTAACAAACCTTTAGCTAGG + Intronic
1015771879 6:136776664-136776686 CACCGACAAATTCTTTAGCTTGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1019082869 6:169447491-169447513 CAACAACCCATCATTGAGCATGG + Intergenic
1022706012 7:32802580-32802602 CAACAATCTAAGCTTTAGCTTGG + Intergenic
1033072088 7:138212839-138212861 GAACAACAAATCCCTTGGCTGGG + Intergenic
1037015376 8:13899822-13899844 CAACAACAATTCCTTTTTCTTGG - Intergenic
1041337642 8:56805321-56805343 CATCAACCATTCCTATAGTTTGG - Intergenic
1043274521 8:78376712-78376734 CAACAAAAAATCTTTTATCTGGG - Intergenic
1044241216 8:89891038-89891060 AATCAACCAATCCTTGATCTTGG - Intergenic
1046384772 8:113495093-113495115 CAACAACTTATCCTTCACCTTGG - Intergenic
1047870573 8:129077488-129077510 CAAAAACCGATCCATTAGCTTGG + Intergenic
1050450970 9:5780667-5780689 GAACATACACTCCTTTAGCTTGG - Intronic
1051488017 9:17629582-17629604 CCCCAAACAATCCTTTAGTTAGG - Intronic
1052264111 9:26551806-26551828 CAACAACCAATTCTATATTTAGG - Intergenic
1055808553 9:80124571-80124593 CAAGAACCAATGCTTTGGCCAGG - Intergenic
1056549455 9:87639619-87639641 AAACAAACACTCATTTAGCTTGG - Intronic
1186586554 X:10881181-10881203 AAACAACCATTCCATTTGCTTGG + Intergenic
1187955826 X:24517516-24517538 CAACAAACAGTCCTTGAGCCGGG - Intronic
1188604867 X:32015807-32015829 CAACACACAATCCATCAGCTTGG - Intronic
1191912428 X:66165144-66165166 TGACAAGCAATCCTTTTGCTAGG + Intronic
1192368643 X:70495831-70495853 CTACACCCAATTCTTTAGCGTGG - Intronic
1193864545 X:86715009-86715031 CAAAAACCATTCCCATAGCTGGG + Intronic
1199272916 X:145906076-145906098 CAACAAACAATTCTTTAATTTGG + Intergenic