ID: 1133754014

View in Genome Browser
Species Human (GRCh38)
Location 16:8748445-8748467
Sequence GCCTAGCGTATGGTCTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1066
Summary {0: 1, 1: 1, 2: 12, 3: 142, 4: 910}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133754010_1133754014 7 Left 1133754010 16:8748415-8748437 CCTGTTAAATTTATTGAGCCTTT 0: 1
1: 0
2: 6
3: 89
4: 462
Right 1133754014 16:8748445-8748467 GCCTAGCGTATGGTCTAGCCTGG 0: 1
1: 1
2: 12
3: 142
4: 910

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133754014 Original CRISPR GCCTAGCGTATGGTCTAGCC TGG Intronic