ID: 1133754014 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:8748445-8748467 |
Sequence | GCCTAGCGTATGGTCTAGCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1066 | |||
Summary | {0: 1, 1: 1, 2: 12, 3: 142, 4: 910} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133754010_1133754014 | 7 | Left | 1133754010 | 16:8748415-8748437 | CCTGTTAAATTTATTGAGCCTTT | 0: 1 1: 0 2: 6 3: 89 4: 462 |
||
Right | 1133754014 | 16:8748445-8748467 | GCCTAGCGTATGGTCTAGCCTGG | 0: 1 1: 1 2: 12 3: 142 4: 910 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133754014 | Original CRISPR | GCCTAGCGTATGGTCTAGCC TGG | Intronic | ||