ID: 1133764664

View in Genome Browser
Species Human (GRCh38)
Location 16:8829571-8829593
Sequence AGGCTCACACTTGCTCCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133764663_1133764664 -6 Left 1133764663 16:8829554-8829576 CCAGCATCAACTTGGCAAGGCTC 0: 1
1: 1
2: 1
3: 23
4: 149
Right 1133764664 16:8829571-8829593 AGGCTCACACTTGCTCCCGTTGG 0: 1
1: 0
2: 3
3: 19
4: 124
1133764662_1133764664 -5 Left 1133764662 16:8829553-8829575 CCCAGCATCAACTTGGCAAGGCT 0: 1
1: 1
2: 5
3: 32
4: 180
Right 1133764664 16:8829571-8829593 AGGCTCACACTTGCTCCCGTTGG 0: 1
1: 0
2: 3
3: 19
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133764664 Original CRISPR AGGCTCACACTTGCTCCCGT TGG Intronic
900447411 1:2688250-2688272 AGGCTGTCACATGCTCCCCTGGG - Intronic
901872589 1:12146742-12146764 GGGCACAGACTTGCTCTCGTGGG + Intergenic
905267331 1:36763929-36763951 AGGCTCCCTCTGGCTGCCGTGGG + Intergenic
907134479 1:52126660-52126682 GGGCTGACACTAGCTCCAGTTGG - Intergenic
907258029 1:53195103-53195125 AGGCTTAGAGTTGCTCCCATTGG + Intergenic
910794643 1:91085406-91085428 AAGCTCAAACTTTTTCCCGTTGG - Intergenic
916732849 1:167581812-167581834 GAGCTCACACTTGGTCCCCTGGG - Intergenic
916918606 1:169438621-169438643 AAGCTCAAACTTTCTCCTGTTGG + Intronic
921148855 1:212384354-212384376 AGAGCCACACTTGCTCCCTTGGG - Intronic
1064304525 10:14153279-14153301 AGGTTCACACTTGCTCCACATGG + Intronic
1068007338 10:51407085-51407107 AGGCCCACACTTAATCCCGGTGG - Intronic
1071463367 10:85919199-85919221 AGGCTCCCACCTGCTCCCTGGGG - Intronic
1072296216 10:94011739-94011761 AGGCTAACAGTTGCTCACCTGGG - Intronic
1072415231 10:95241668-95241690 AGGCTCACATCTGCTCACGTTGG - Intronic
1073450003 10:103603584-103603606 TGGCTCTCACTGGCCCCCGTAGG + Exonic
1074775683 10:116766867-116766889 AAGCTCACACTGGCACCCGTAGG + Intergenic
1075207157 10:120457508-120457530 AGGGTCTCTCTTGGTCCCGTAGG - Intronic
1075506899 10:123031891-123031913 AGGCTCACAGTTGTGTCCGTGGG + Intronic
1075827795 10:125374748-125374770 TGGCTCACACCTGCTCACGAGGG - Intergenic
1077492891 11:2870302-2870324 AGGCTCTCCCTTGCTCCCCCAGG + Intergenic
1077926633 11:6687685-6687707 AGGCTCAAACTTTCTCCCATTGG - Intergenic
1078835538 11:15025963-15025985 AGACTCAAACTTTCTCCCCTTGG + Intronic
1081980125 11:47261053-47261075 AGTCTCACACTTGCTCAGGCTGG - Intronic
1082614706 11:55344709-55344731 TGGCTCACACTTGCAATCGTAGG + Intergenic
1083694737 11:64435142-64435164 AGTCTCACACGTGCTCCCGTCGG - Intergenic
1084153342 11:67301404-67301426 AGGCTCCCTCTTCCTCCCGTTGG - Intronic
1084238149 11:67801393-67801415 TGGTTCACACTGGCTCCCCTGGG - Intergenic
1084661397 11:70548578-70548600 AGGCTGTCACTTTCTCCCCTAGG + Intronic
1084834259 11:71791441-71791463 TGGTTCACACTGGCTCCCCTGGG + Intronic
1089928741 11:122287366-122287388 TGGCTCAAACTTCATCCCGTGGG - Intergenic
1092408821 12:8239025-8239047 TGGTTCACACTGGCTCCCCTGGG - Intergenic
1093101642 12:15036333-15036355 AAGCTCAAACTTTTTCCCGTTGG + Intergenic
1095942075 12:47733864-47733886 AGGCCCAGAGCTGCTCCCGTTGG - Intergenic
1100295117 12:93254029-93254051 AGGCTCAAACTTTCTCCTCTTGG + Intergenic
1101292653 12:103387407-103387429 ATGCTCACGCTTACTCCCCTTGG + Intronic
1107427202 13:40306093-40306115 AGGCTCAAACTTGCCCCTGTTGG + Intergenic
1111189351 13:84788550-84788572 AGGCTCAAACTTTCTCCTGTTGG - Intergenic
1113592827 13:111512824-111512846 GGGCTGACGCTTGCTCCCATGGG + Intergenic
1116066421 14:39989292-39989314 ATGCTCACAGTGGCTCTCGTAGG + Intergenic
1123477676 15:20602055-20602077 AGGCTCAAACTTTCTCCTGTTGG - Intergenic
1123640339 15:22398327-22398349 AGGCTCAAACTTTCTCCTGTTGG + Intergenic
1125584575 15:40810901-40810923 AGGCTTACACTGGCTCCCTTTGG - Intronic
1125810890 15:42540164-42540186 AGGCTCACTCTTGCCCACGCTGG - Exonic
1126085344 15:45005854-45005876 AGGCTCAAACTTTCTCATGTTGG - Intergenic
1127230376 15:56985880-56985902 AGCCTCACAGTTGGTCCTGTTGG - Intronic
1129377400 15:75142642-75142664 AAGGTCACACTTGCACCCATGGG - Intergenic
1131992910 15:98108048-98108070 AAGCTCACTCATGCTCCCTTTGG + Intergenic
1132882390 16:2168180-2168202 AGGCTCACACGGGCTCCTGGGGG - Intronic
1133349790 16:5093840-5093862 TGGTTCACACTGGCTCCCCTGGG - Intronic
1133764664 16:8829571-8829593 AGGCTCACACTTGCTCCCGTTGG + Intronic
1136394996 16:29987776-29987798 AGCATCCCACTTGCCCCCGTGGG + Exonic
1138229070 16:55324597-55324619 ACACTCACACTTGCTCCGGGAGG - Exonic
1138588590 16:57986969-57986991 CGGCTCACACTCCCTCCCATTGG + Intronic
1141058613 16:80842865-80842887 ATGCTCTCGCTTTCTCCCGTGGG - Intergenic
1143584972 17:7846456-7846478 AGTTCCACACTTGCTCCAGTGGG - Exonic
1148576096 17:48712361-48712383 AGGCTCTTACCTGCTGCCGTGGG - Intergenic
1149505261 17:57188983-57189005 AGACTCTCTCTTGCTCCAGTTGG - Intergenic
1150349309 17:64430471-64430493 AGGCTCAAAATTGCCCCTGTTGG + Intergenic
1152845506 17:82597287-82597309 AGGCCCACACGTGCTCTCTTGGG - Intronic
1153893631 18:9540170-9540192 AGGCTCACACCTGCCCACTTAGG + Intergenic
1160452783 18:78977375-78977397 AGTCTCACACTTGCCTTCGTTGG + Intergenic
1164677078 19:30108516-30108538 AGGAGCTCACTTGCTCCCTTTGG + Intergenic
1166058811 19:40311621-40311643 AGGCTCACACTTCCTTCAGGTGG + Intergenic
1168622858 19:57892919-57892941 AGGCTCAAACTTGCCCTGGTTGG - Intronic
926056753 2:9778216-9778238 AGGCACACACAGGCTCACGTGGG + Intergenic
929931855 2:46263458-46263480 AGGCCCATTCTTGCTCCTGTGGG - Intergenic
938213270 2:129486250-129486272 AGGCACACACTTGCACACTTTGG + Intergenic
938668527 2:133564785-133564807 AGGCTCACAGGTGCCACCGTGGG + Intronic
939843811 2:147220164-147220186 AGGCTCAAACATGCCCCTGTTGG + Intergenic
940400306 2:153241301-153241323 AGTCTCAAACTTTCTCCCATTGG - Intergenic
940840423 2:158573817-158573839 AGGCCCAGATTTGCTCCCTTTGG - Intronic
941639484 2:167971875-167971897 AGGCTCAAACTTGCCCCTGGTGG - Intronic
941877913 2:170453826-170453848 AGGCTCAAACTTTCTCCCATTGG + Intronic
945975603 2:216268129-216268151 AGGCTGACACTTGTGACCGTGGG - Intronic
946269386 2:218577736-218577758 AGTCACACACTGGCTCCAGTAGG + Intronic
946362495 2:219227914-219227936 GAACTCACACTTGCTCCCCTCGG + Exonic
948580896 2:238986612-238986634 AGGCTCGCTCTCGCTCCCCTGGG + Intergenic
948895534 2:240925262-240925284 AGGTCCACACTTGCTGCAGTAGG - Intronic
1169640284 20:7743627-7743649 AGGCTGACACTTGTTCCTGTTGG + Intergenic
1170903251 20:20486818-20486840 AGGCTCACAATTCCTCTCCTTGG + Intronic
1175653917 20:60752376-60752398 AGGCTCAGTCTTGCCCCTGTGGG - Intergenic
1180955744 22:19740477-19740499 GAGTTCACACTTGCTCCCATAGG - Intergenic
1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG + Intronic
1181876870 22:25946296-25946318 AGGCCCACACTAGCTCCCAGAGG - Intronic
1182619830 22:31613015-31613037 AGGCTCCCACTTCCTCCACTAGG - Intronic
1183326006 22:37194731-37194753 AGGCTCAAACTTGCTCCCGATGG + Intronic
1184672454 22:46022050-46022072 AGGCTCATACCTGCTCCTGACGG - Intergenic
950652357 3:14415256-14415278 AGGCTCACACTGGCACCCACTGG - Intronic
953177773 3:40567513-40567535 AGGCTCAAACTTGCCCCTGTTGG + Intronic
957054091 3:75431190-75431212 TGGTTCACACTGGCTCCCCTGGG - Intergenic
958968563 3:100586358-100586380 AGGCTGAAACTTTCTCCCATTGG + Intergenic
961300747 3:125920523-125920545 TGGTTCACACTGGCTCCCCTGGG + Intergenic
961887756 3:130107565-130107587 TGGTTCACACTGGCTCCCCTGGG - Intronic
968996893 4:3951497-3951519 TGGTTCACACTGGCTCCCCTGGG - Intergenic
969323488 4:6427096-6427118 AGTGTCACACTTGCTCCCCTTGG - Intronic
969757115 4:9157181-9157203 TGGTTCACACTGGCTCCCGTGGG + Intergenic
969817068 4:9694746-9694768 TGGTTCACACTGGCTCCCCTGGG + Intergenic
970558564 4:17260110-17260132 AGGCTCTCTCTTGCTCCCTTTGG + Intergenic
972017196 4:34262149-34262171 AGGCTAGCTCTTGCTCCCCTGGG - Intergenic
977527014 4:98157863-98157885 AGGCTCATACTTTCTCCTGTTGG - Intergenic
979393458 4:120156158-120156180 AGGTTCAGACTTGTTTCCGTTGG - Intergenic
980262351 4:130467499-130467521 AGTCTCACAATTACTCCAGTTGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG + Intronic
985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG + Intronic
986531475 5:8740837-8740859 AGGCTCACAGGTGGTCCTGTTGG + Intergenic
988634697 5:32970248-32970270 TAGCTCATACTTGCTCCTGTAGG + Intergenic
993745626 5:91593475-91593497 AGCCTTAAACTTGCCCCCGTTGG + Intergenic
996002560 5:118382118-118382140 AAGTTCACACTTGCTCCCTCTGG - Intergenic
1001842709 5:174892834-174892856 AGGCTCAGACTTTCTCCTATTGG - Intergenic
1004243652 6:13951949-13951971 AGGCTCAAACTTGCCCCTTTTGG + Intronic
1006196691 6:32247304-32247326 AGGCTCAAACTTGCCCCCATTGG - Intergenic
1013298316 6:108780182-108780204 AGCCCCACTCTTGCTCTCGTGGG - Intergenic
1014181494 6:118389365-118389387 AGGCTCACTCTTGCTCTGGGAGG + Intergenic
1016742297 6:147541438-147541460 AAGCTCAAACTTTTTCCCGTTGG + Intronic
1018189148 6:161293135-161293157 AGGCTCAAACTTTCTCCTCTTGG - Intergenic
1018801765 6:167228085-167228107 AAGCCCAAACTTTCTCCCGTTGG - Intergenic
1019336714 7:486546-486568 AGGCTCACGCATTCTCACGTAGG - Intergenic
1020321182 7:6939879-6939901 TGGTTCACACTGGCTCCCCTGGG - Intergenic
1023800246 7:43827462-43827484 AAGCTCAAACTTCTTCCCGTTGG - Intergenic
1025953862 7:66167535-66167557 AGATTCACACTTGATCCCTTTGG + Intergenic
1029679964 7:102101557-102101579 ACGCTAACGCTTGCTCCAGTGGG - Intronic
1032450002 7:132022474-132022496 AGACTCTCACTTGGTCCCTTAGG + Intergenic
1034250455 7:149686444-149686466 AGGCTCAAACTTGCCCCCATTGG + Intergenic
1035904919 8:3499456-3499478 ATGCTCACACATGCTCCCCAGGG - Intronic
1036380346 8:8232496-8232518 TGGTTCACACTGGCTCCCCTGGG + Intergenic
1036849215 8:12190164-12190186 TGGTTCACACTGGCTCCCCTGGG - Intronic
1036870576 8:12432438-12432460 TGGTTCACACTGGCTCCCCTGGG - Intronic
1037314307 8:17586284-17586306 AGGCACACACTGGATCCCCTCGG - Intronic
1039399911 8:37260900-37260922 AGGCTCCCAACTGCCCCCGTGGG + Intergenic
1041228910 8:55729841-55729863 AGGTTCAAACTTGCCCCCATTGG + Intronic
1044385948 8:91588366-91588388 ATGCTCTCACTTTCTCCCATAGG + Intergenic
1045348476 8:101316297-101316319 AGCCTCAGCCTTGCTCCCTTGGG - Intergenic
1049507638 8:143012175-143012197 AGGCTCAGACTTGCCCCCTGTGG + Intergenic
1049603707 8:143519594-143519616 GTGCTCACACTGGCACCCGTGGG + Intronic
1051440491 9:17077697-17077719 AGTTTCACACTTGCTCACATGGG - Intergenic
1052019804 9:23512588-23512610 AGGCCCACTCCTGCTCCCTTTGG - Intergenic
1052937573 9:34105776-34105798 AGTCTCACACTTGCTCAGGCTGG + Intronic
1055424834 9:76183700-76183722 AGGCTCAGACTTGATCCAGCAGG + Intronic
1060306842 9:122421387-122421409 AGGCTCAAACTTTCTCCCATTGG + Intergenic
1061894124 9:133638163-133638185 AGGCTGACATTTGCTTTCGTAGG - Intronic
1186962273 X:14749354-14749376 AGGCTCACACTTGTAGACGTAGG + Intergenic
1188946923 X:36316809-36316831 ATGGTCTCACTTGGTCCCGTAGG + Intronic
1193179895 X:78442261-78442283 AGGCTCAAACTTGCTCCCATTGG + Intergenic
1198464831 X:136895474-136895496 AGCCTCATACATGCTCCCCTGGG - Intergenic
1200103565 X:153700368-153700390 AGGCTCACACCTGTTCTCGAAGG - Intergenic