ID: 1133764670

View in Genome Browser
Species Human (GRCh38)
Location 16:8829611-8829633
Sequence CCTTCCCACCTTGAGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133764670_1133764676 3 Left 1133764670 16:8829611-8829633 CCACTCCACTCAAGGTGGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1133764676 16:8829637-8829659 GCCTTCCACCGGGAATTCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 77
1133764670_1133764678 7 Left 1133764670 16:8829611-8829633 CCACTCCACTCAAGGTGGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1133764678 16:8829641-8829663 TCCACCGGGAATTCAAAGGATGG 0: 1
1: 0
2: 0
3: 13
4: 118
1133764670_1133764681 23 Left 1133764670 16:8829611-8829633 CCACTCCACTCAAGGTGGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1133764681 16:8829657-8829679 AGGATGGTCTCTGAGCCAGATGG 0: 1
1: 0
2: 1
3: 17
4: 215
1133764670_1133764674 -8 Left 1133764670 16:8829611-8829633 CCACTCCACTCAAGGTGGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1133764674 16:8829626-8829648 TGGGAAGGGACGCCTTCCACCGG 0: 1
1: 0
2: 0
3: 14
4: 107
1133764670_1133764675 -7 Left 1133764670 16:8829611-8829633 CCACTCCACTCAAGGTGGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 163
Right 1133764675 16:8829627-8829649 GGGAAGGGACGCCTTCCACCGGG 0: 1
1: 0
2: 0
3: 18
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133764670 Original CRISPR CCTTCCCACCTTGAGTGGAG TGG (reversed) Intronic
900636620 1:3669219-3669241 CCTTGCCACCGTGGGTGCAGTGG + Intronic
901950340 1:12740332-12740354 CATTCCCACCATGAGTGTACGGG - Intergenic
902396100 1:16133144-16133166 CCTGCCCACACTGGGTGGAGAGG - Intronic
904333947 1:29785018-29785040 CTTGACCACCTTGAGTGGGGAGG + Intergenic
905015685 1:34777023-34777045 CTTTCCTTCCTTGAGTGGAGAGG - Intronic
907198290 1:52704896-52704918 TCATCCCACCTGGAGTGCAGTGG - Intergenic
907811671 1:57876992-57877014 CCTTCCCACCAAGTTTGGAGGGG - Intronic
908742336 1:67341800-67341822 CATTCCCACCCTCAGTTGAGTGG - Intronic
916312479 1:163412420-163412442 CCTCCTCACATTGAGTAGAGGGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919726665 1:200888880-200888902 CCTTCCCACTTTGGCTGAAGGGG - Intergenic
922712441 1:227844327-227844349 CCTACCCCCCATGAGTGGTGAGG + Intronic
922903269 1:229154820-229154842 GCTTCCCACAATGAGTGGAGGGG - Intergenic
923651498 1:235878265-235878287 CATTCCCACCCTGAGTGATGAGG + Intronic
923841890 1:237681730-237681752 CCTTCCCACCTTCACTGGGAGGG + Intronic
1063468047 10:6260997-6261019 TCTTCCCACCTGTAGTGGACAGG + Intergenic
1064149127 10:12848511-12848533 TCTTCCCCCCTGCAGTGGAGGGG - Intergenic
1065196692 10:23273686-23273708 CCTTCTTCCCTTGAATGGAGTGG - Intronic
1065297933 10:24294223-24294245 CCTTTCCACGTGGAGTGGACTGG + Intronic
1067237641 10:44465063-44465085 CCTTCCCACACTGAGTGCTGTGG + Intergenic
1069085631 10:64136536-64136558 CCCTCCCACCTTGAGTTAACCGG - Intergenic
1070204505 10:74243086-74243108 CCTTACCACATTGCGTGGGGTGG - Intronic
1070352107 10:75602424-75602446 CAGCCCTACCTTGAGTGGAGAGG - Intronic
1074928241 10:118095540-118095562 ACTTCCCTCCTTGAGAGGTGTGG - Intergenic
1075211547 10:120495439-120495461 CCTTCCTGCCAAGAGTGGAGTGG + Intronic
1075738056 10:124676336-124676358 GCTTCCCACCCTGAGAGGAAGGG + Intronic
1077061823 11:620896-620918 CCTTCCCATCTTGAGCGGTGAGG - Intronic
1077196782 11:1285004-1285026 CCAGCCCAGCTGGAGTGGAGAGG - Intronic
1079125179 11:17713964-17713986 CCTTCCCACCCAGTGTGCAGGGG - Intergenic
1081991585 11:47340916-47340938 TCTTCCCTCTGTGAGTGGAGGGG + Intronic
1082059130 11:47845743-47845765 TTTTCCCACCTGGAGTGCAGTGG + Intronic
1082799822 11:57406308-57406330 CATTCCCACCTTGCTAGGAGAGG - Intronic
1085417408 11:76328465-76328487 CATTCCTACCCTGAGTGGAGGGG + Intergenic
1087382485 11:97424203-97424225 CCTTTTCACCCTGAGTGCAGTGG - Intergenic
1088988055 11:114927338-114927360 CCTTATCACCTGAAGTGGAGTGG + Intergenic
1089098121 11:115936737-115936759 CCTTCTCTCCTAGAGGGGAGTGG - Intergenic
1089613983 11:119684960-119684982 CCTCCCCATCCTGAGTGTAGAGG - Intronic
1089883683 11:121798929-121798951 CTTTCTCACCTAGAGTTGAGAGG + Intergenic
1090009746 11:123035683-123035705 CATTCCCACCAAGAGTGGAGAGG - Intergenic
1090160336 11:124486475-124486497 CCTTCCCAGTTTTATTGGAGAGG + Intergenic
1092816900 12:12320322-12320344 CCTTCCAAGCTGCAGTGGAGAGG - Intergenic
1096864281 12:54552310-54552332 CCTTCCCACCTTGACCAAAGGGG - Intronic
1102254673 12:111408640-111408662 CCTCCCCACCTTGGCTGGGGAGG - Intronic
1103932836 12:124459676-124459698 CCTTCCCTCTTTGAATGCAGAGG + Intronic
1107657587 13:42607241-42607263 CCTTCGCAGCTGAAGTGGAGAGG + Exonic
1107886248 13:44876555-44876577 CCTTCCCACGTCTGGTGGAGGGG + Intergenic
1107886508 13:44878231-44878253 TCTTACCACCTCGAGTGGGGTGG - Intergenic
1111994814 13:95155182-95155204 CCTTCCCAGCTTGACTGAATGGG - Intronic
1113903897 13:113810695-113810717 CCTTAACGCCTTCAGTGGAGAGG + Intronic
1116055529 14:39859665-39859687 CATTACTACCATGAGTGGAGAGG + Intergenic
1116925002 14:50625494-50625516 CTTTCCCAGCTAGAGAGGAGAGG + Intronic
1117047366 14:51827034-51827056 CCTGCCCACCTTGAAGGGTGTGG - Intronic
1119353037 14:73981765-73981787 TCTTCCAAGCTTGAGTGCAGTGG - Intronic
1121788373 14:96680065-96680087 CCTTCCCACTTTGAGCAGAGGGG + Intergenic
1122890555 14:104730191-104730213 CCTTAACACCTGGAGGGGAGCGG + Exonic
1128069146 15:64783191-64783213 CATTGCCACCTTCAGTGGTGAGG - Intergenic
1129419199 15:75409827-75409849 CATTCTCACCTTAACTGGAGGGG + Exonic
1129870205 15:78935017-78935039 CCTACCCACCTTCCGTGGACTGG - Exonic
1129943461 15:79518833-79518855 CCATCCCAACTTGATTGGATGGG - Intergenic
1133764670 16:8829611-8829633 CCTTCCCACCTTGAGTGGAGTGG - Intronic
1133843144 16:9428582-9428604 TCCTCCCACCTGGAGGGGAGGGG + Intergenic
1134248379 16:12556890-12556912 TCTCCTCACCTTGAGTGTAGTGG + Intronic
1136276841 16:29183828-29183850 CCTGTCCACCTGGAGAGGAGGGG - Intergenic
1138383239 16:56618005-56618027 CCTTCCCAGCACGAGTGGAGAGG + Intergenic
1138384395 16:56626294-56626316 CCTTCCCAGCGTTAGTGGAGAGG + Intronic
1138385494 16:56633179-56633201 CCTTCCCAGCGTTAGTGGAGAGG + Intronic
1138386052 16:56636267-56636289 CCTTCCCAGTGTGAGTGGAGAGG + Intergenic
1138388439 16:56652399-56652421 CCTTCCCAGCCTGAGTGGAGAGG + Intronic
1138389298 16:56658500-56658522 CCTTCCCAGCATGAAGGGAGAGG + Intronic
1138481812 16:57308119-57308141 CATTCCCAGCATGAGAGGAGAGG - Intergenic
1141169915 16:81684785-81684807 CCTTCCCAGCTTGGACGGAGGGG - Intronic
1141296882 16:82778052-82778074 CCACCCCACCCTCAGTGGAGGGG + Intronic
1141779875 16:86152345-86152367 CCCTTCTGCCTTGAGTGGAGAGG - Intergenic
1141784940 16:86193242-86193264 CCTCGAGACCTTGAGTGGAGTGG + Intergenic
1142081219 16:88149888-88149910 CCTGTCCACCTGGAGAGGAGGGG - Intergenic
1142264332 16:89056858-89056880 CCTTCCCGTCTTCAGTGAAGCGG + Intergenic
1147357811 17:39911361-39911383 CTTGCTCTCCTTGAGTGGAGCGG - Intronic
1149296085 17:55264034-55264056 CCTTCCCGCCTGGGGTGGTGCGG - Intergenic
1151220188 17:72606211-72606233 TCTTCCCACAGTCAGTGGAGGGG - Intergenic
1151687552 17:75657636-75657658 TCTTCCCACCTTGAGTAGCTGGG - Intronic
1152067306 17:78118857-78118879 CCCTCCCCACCTGAGTGGAGTGG - Intronic
1152230096 17:79110053-79110075 CCTTCCCACACTGACTGTAGCGG + Intronic
1155225066 18:23722211-23722233 CCTTCCCACCTTGCCTGGTCTGG + Intronic
1156891740 18:42198210-42198232 CCTTCCCACATTTAGTGAAGGGG - Intergenic
1157335449 18:46734089-46734111 CCTTCCCACCCAGATTAGAGCGG + Intronic
1157815824 18:50729028-50729050 CCCTCCCACCTTGAGGGATGGGG + Intronic
1158201976 18:54951342-54951364 CCTTCCCATCTGGAGAAGAGTGG + Intronic
1161054850 19:2185411-2185433 TCTCTCCACTTTGAGTGGAGGGG + Intronic
1161632683 19:5366680-5366702 GCTTCCTCCCTTGAGAGGAGGGG - Intergenic
1163795905 19:19337892-19337914 CCTTCCCGGCTGCAGTGGAGGGG + Intronic
1165766153 19:38352482-38352504 CCCAGCCACCTTCAGTGGAGGGG - Intronic
1166100490 19:40568634-40568656 CCTCACCTCCTTGATTGGAGAGG + Intronic
1167941957 19:52954771-52954793 CCTCCCCGCCTGGAGTGTAGTGG - Intronic
924972014 2:136911-136933 CCAGTCCACCTTCAGTGGAGAGG - Intergenic
931023811 2:58084391-58084413 CCTTACCATCTTGATTAGAGAGG - Intronic
931246952 2:60499720-60499742 CCGCTCAACCTTGAGTGGAGAGG + Intronic
936383670 2:112010308-112010330 CCTTACCAACTTGAGTTGGGTGG + Intronic
937283528 2:120736194-120736216 CCATCCCACCTTGGCTGGCGCGG - Intronic
938202675 2:129388229-129388251 TCTTCCCACCTTGAGCAGAGTGG - Intergenic
940146355 2:150548782-150548804 CCATCCCATATTGAGTGGTGTGG - Intergenic
940282772 2:152004605-152004627 CCCTCCTGCCTTCAGTGGAGTGG + Intronic
940718680 2:157258023-157258045 CCTGCTTACCTTGAGTGGAGAGG - Exonic
942821925 2:180124784-180124806 TCTTCCCTCCTTGGCTGGAGGGG + Intergenic
943669909 2:190649222-190649244 CCTTCCCCCCTCGATGGGAGCGG + Exonic
943955242 2:194180487-194180509 CCTTCCCATCTTGAGAGTAATGG - Intergenic
945345007 2:208702906-208702928 GCTCTCCACTTTGAGTGGAGGGG + Intronic
946250012 2:218406075-218406097 CCTTCCCACCTGAAGTGTCGAGG - Intergenic
949078881 2:242080565-242080587 CCTGTCCACCGTGACTGGAGGGG - Intergenic
1168812980 20:718370-718392 CCTTCCCTTCCTGAGAGGAGAGG + Intergenic
1169930382 20:10826485-10826507 CCTTTCCACCTTGAGTGTATAGG + Intergenic
1172008462 20:31832925-31832947 CCTCCCCAGCTGGAGTGCAGTGG + Intronic
1176011616 20:62899867-62899889 CTGTCCCACCTGGAGTGGAATGG - Intronic
1178010503 21:28280205-28280227 CCATCCCAGCTGGAGTGCAGTGG - Intergenic
1178384774 21:32140204-32140226 CCTTCCCACCTCCACTGGAGAGG - Intergenic
1179439271 21:41381763-41381785 CATTCCCACCAGCAGTGGAGGGG - Intronic
1181725550 22:24808453-24808475 CCTTGTCACTTTCAGTGGAGGGG + Intronic
1182800047 22:33024726-33024748 CCTTCCCTCATTGAGTGCACTGG - Intronic
1183687512 22:39369713-39369735 CCATCACCCCTAGAGTGGAGAGG - Intronic
1184090976 22:42292929-42292951 CCTGCCCACCAGGAGTGGCGGGG + Intronic
952605670 3:35144693-35144715 CTGTACCACCTTGAGTTGAGGGG - Intergenic
952834816 3:37593819-37593841 CCTTCTCACCTGAAGTGGATGGG - Intronic
953184485 3:40625401-40625423 TCTTCCTACCTTGAATGGAGAGG + Intergenic
953407346 3:42666003-42666025 CCTTCCCAGCATGGCTGGAGTGG + Intergenic
953979846 3:47408080-47408102 CCTTCCCGCCTGGGGTGGTGGGG + Intronic
954189987 3:48952668-48952690 CAGTCCTACCTTGAGAGGAGTGG + Intronic
961558181 3:127710894-127710916 ACTTCCCACCTTGGGCGCAGCGG - Intronic
963793194 3:149604997-149605019 CCTTCCCTCCTTCAGTGCACAGG - Intronic
964083384 3:152787511-152787533 TCTTACGACCTTGAGAGGAGAGG + Intergenic
964142817 3:153422603-153422625 CTTTCCCACCTCCAGTGCAGTGG + Intergenic
966111562 3:176408784-176408806 CCTTCCCAGCTTGGGGGTAGGGG - Intergenic
966665052 3:182463200-182463222 CCTTTCAGCCATGAGTGGAGCGG - Intergenic
968398173 4:262888-262910 CATTCCCACCCTGAATGAAGAGG - Intergenic
968613622 4:1567804-1567826 CCTTCCACCCATGTGTGGAGGGG - Intergenic
970422083 4:15914829-15914851 CTTGCCCACCCTGAGTGGTGTGG - Intergenic
970469124 4:16358450-16358472 GTTTCCCACCTGGAGTGCAGTGG - Intergenic
973562190 4:52148464-52148486 ACTTCCCAGCTTGTGTGGTGAGG - Intergenic
974752578 4:66160212-66160234 GCTGCCCACCTGGAGTGCAGTGG + Intergenic
981076205 4:140595035-140595057 CCTTCTCATCTGGAGAGGAGTGG + Intergenic
981252281 4:142617533-142617555 TCTTCACACCTAGAGTGGAAGGG + Intronic
981690303 4:147500671-147500693 CCTTCCAAGCTGGAGTGCAGTGG - Intronic
984513012 4:180701778-180701800 CCTTACCTCATTGTGTGGAGTGG + Intergenic
984860876 4:184236838-184236860 CTGTCCCACCCTCAGTGGAGAGG - Intergenic
989047020 5:37283350-37283372 CCTTTTCATCATGAGTGGAGCGG + Intergenic
989456716 5:41652551-41652573 GCTTCCCAGCATGAGTGGAGAGG + Intergenic
995288269 5:110417316-110417338 TCTTCCCACTTTGAGTTGATAGG - Intronic
999371039 5:151055582-151055604 CCATCCCACCTGGAGGGGAGGGG - Intronic
999936730 5:156494759-156494781 CCTCCCTACCTTGTGTAGAGGGG + Intronic
1000345549 5:160311145-160311167 CCTTCTCTCCTTGAGGGGAGGGG + Intronic
1002835896 6:865097-865119 AGTTCCCACCTTGTGTGAAGAGG + Intergenic
1006941734 6:37756200-37756222 CCTCCCCACCCTCAGTGAAGGGG + Intergenic
1008010888 6:46466519-46466541 CCTTTCCTCCTTGAGTTGAAAGG - Intronic
1008859041 6:56127106-56127128 ACTTCCCACCATGAATGCAGAGG + Intronic
1010662169 6:78583866-78583888 TCTTCCCACCTTGCTGGGAGGGG - Intergenic
1016999469 6:149985926-149985948 CTCTCCCACTTTGAGTGGGGAGG + Intergenic
1018793339 6:167167319-167167341 CCTTACCACCTTGCTTAGAGGGG + Intronic
1019497288 7:1346491-1346513 CCTTCCGGCCCTGAGTGCAGAGG - Intergenic
1022521956 7:31014156-31014178 ACTTCCCACCTTGAGTGCTCTGG + Intergenic
1024007460 7:45237535-45237557 CCTACCGACCTTGAGTTGATTGG - Intergenic
1024524088 7:50333366-50333388 CCTTCCCTCCCAGAGTGTAGAGG - Intronic
1026989199 7:74573718-74573740 CCTTCCAGCCTTGTGGGGAGGGG + Intronic
1027420486 7:78013319-78013341 CCTGCCCACCTGGAATGGAGGGG - Intergenic
1033202948 7:139390111-139390133 CCTTCCAACCTGGAGTGCAGTGG - Intronic
1033600416 7:142885057-142885079 CCGTCCCCTCTTGGGTGGAGGGG + Intronic
1034269728 7:149797724-149797746 CCTTCCCACCTGGAATGGCCTGG + Intergenic
1035052052 7:156004696-156004718 CGTTCACGCCATGAGTGGAGGGG - Intergenic
1035537143 8:400584-400606 CCTGCCCACCGTGACTGGAGGGG - Intergenic
1036028987 8:4944783-4944805 CATTCCCACCAAGAGTGCAGCGG - Intronic
1037541439 8:19875776-19875798 CATTCCCACCTTGAGTTCATTGG + Intergenic
1039828213 8:41192759-41192781 TCTTCCCACCTGCAGTGAAGGGG - Intergenic
1042020185 8:64364644-64364666 CTTAGGCACCTTGAGTGGAGAGG + Intergenic
1043221137 8:77665948-77665970 CCTTCCCATTTTGATTGAAGTGG - Intergenic
1045130707 8:99148949-99148971 CCTTCCCATCTTGAGAGAGGCGG - Intronic
1045352890 8:101358724-101358746 CCTTGCCACAGTGAGTGGACAGG + Intergenic
1049511526 8:143029121-143029143 CCTTCCCACCTGGGGAGGAGAGG + Intergenic
1049717304 8:144099072-144099094 CGTGCCCACCTGGAGTGGACTGG + Exonic
1049799292 8:144510346-144510368 CCTGCTCACCTTGGGTGGTGGGG - Exonic
1051707931 9:19900021-19900043 CCTTCACTACTTGAGGGGAGGGG + Intergenic
1054809686 9:69425149-69425171 CCTTGCCTCCCAGAGTGGAGTGG - Intergenic
1056807352 9:89739143-89739165 CCTTACCACCTAGAGTAGTGTGG + Intergenic
1059164624 9:112066385-112066407 CCTTCCCAGCTTGAGTACACAGG + Intronic
1059438222 9:114288995-114289017 GCCTCCCACCCTGAGTGGGGCGG + Intronic
1061265729 9:129503862-129503884 TCTTCCCCCCTTGCATGGAGAGG - Intergenic
1061404540 9:130386078-130386100 CCCTCCCTCCTTCCGTGGAGTGG + Intronic
1062034980 9:134378987-134379009 CCTTCCCTCCTTGAGGGTGGGGG + Intronic
1187391733 X:18890659-18890681 CAACCCCACCTGGAGTGGAGTGG - Intergenic
1189774796 X:44461144-44461166 TAGTCCCACCTTGGGTGGAGAGG - Intergenic
1192227501 X:69239109-69239131 CCTTGCCAAGCTGAGTGGAGGGG + Intergenic
1200422986 Y:2992015-2992037 TCACCCCACCTTGAGTGCAGTGG + Intergenic