ID: 1133770226

View in Genome Browser
Species Human (GRCh38)
Location 16:8863463-8863485
Sequence CTGAGTGCACACCAATGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133770226_1133770235 30 Left 1133770226 16:8863463-8863485 CCACTGCATTGGTGTGCACTCAG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1133770235 16:8863516-8863538 CATTCCTGCTCACCTGATAGTGG 0: 1
1: 0
2: 1
3: 15
4: 129
1133770226_1133770227 -2 Left 1133770226 16:8863463-8863485 CCACTGCATTGGTGTGCACTCAG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1133770227 16:8863484-8863506 AGCACCATGCCCAGCCCAGCAGG 0: 1
1: 0
2: 6
3: 87
4: 527
1133770226_1133770228 1 Left 1133770226 16:8863463-8863485 CCACTGCATTGGTGTGCACTCAG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1133770228 16:8863487-8863509 ACCATGCCCAGCCCAGCAGGAGG 0: 1
1: 0
2: 14
3: 79
4: 581
1133770226_1133770230 4 Left 1133770226 16:8863463-8863485 CCACTGCATTGGTGTGCACTCAG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1133770230 16:8863490-8863512 ATGCCCAGCCCAGCAGGAGGTGG 0: 1
1: 0
2: 2
3: 35
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133770226 Original CRISPR CTGAGTGCACACCAATGCAG TGG (reversed) Intronic
901336499 1:8453753-8453775 CTGAGATCACACCATTGCACTGG + Intronic
901422759 1:9162165-9162187 GTGAATGCACACCTATGGAGGGG - Intergenic
905394132 1:37656485-37656507 CCGAGAGCACACCACTGCACTGG - Intergenic
908286278 1:62607153-62607175 CTGAGATCACACCAATGCACTGG + Intronic
908678370 1:66631487-66631509 CTGTGTCCACACAGATGCAGAGG - Intronic
909197628 1:72648259-72648281 CTGAGAAGACACCACTGCAGTGG + Intergenic
917000697 1:170354873-170354895 CTGAGGGCAGTCCAATGCAAGGG - Intergenic
920391669 1:205607354-205607376 CTGAGATCACACCACTGCACTGG - Intronic
921135830 1:212258264-212258286 CTGTGTACACAGCACTGCAGTGG + Intergenic
922823242 1:228498792-228498814 CAGACTGCACTCCAAAGCAGCGG - Intergenic
922956242 1:229603190-229603212 CAGAGTTCACAACAATACAGTGG + Intronic
1063254557 10:4312000-4312022 CTTAGTACAAACCAAGGCAGTGG + Intergenic
1064138630 10:12771648-12771670 CTGTGTGGACACCATCGCAGGGG + Intronic
1066567839 10:36738871-36738893 CTGTATGCACACATATGCAGGGG - Intergenic
1068962348 10:62878690-62878712 CTAAGAGCACACCACTGAAGTGG - Intronic
1070890515 10:79939588-79939610 TTAAGTGCACACACATGCAGTGG + Intronic
1073095725 10:100978611-100978633 CTGAGGAGACACCAATGCATTGG + Exonic
1074120770 10:110493201-110493223 CAGAGTGCCCACAAGTGCAGGGG - Intergenic
1075361227 10:121836387-121836409 CAGAGTGAAGACCAATGCAGAGG - Intronic
1079104944 11:17564622-17564644 CTGGGTGCCCAGCAATGGAGTGG + Intronic
1080709920 11:34737184-34737206 CTGAGTGCCCAGCAATGCACTGG - Intergenic
1081449031 11:43155290-43155312 GTGAGTGTACACCAATCCTGTGG + Intergenic
1084143230 11:67248443-67248465 CTGTGTGAACACTAATGCAAAGG - Intronic
1085344382 11:75758509-75758531 CAGAGTGCACATGATTGCAGAGG + Intergenic
1086001158 11:81987163-81987185 CAGAGTGGACACCAAGGCTGAGG + Intergenic
1090424449 11:126597323-126597345 CTGAGTTCACATCAGTGCTGAGG + Intronic
1090939169 11:131372487-131372509 CTGGGTGCACAAGAATGAAGTGG + Intronic
1091252816 11:134158098-134158120 CTCACTGCAGACCACTGCAGAGG + Intronic
1092627262 12:10339911-10339933 CTGAGTGAACAGCAATGTATTGG + Intergenic
1093553433 12:20442609-20442631 CTTAGTTCACACCACTGCAATGG + Intronic
1096916159 12:55035709-55035731 CTGTGTGCACACGATTGCACTGG - Intergenic
1097540800 12:60939667-60939689 CTGAGGACACAGCAATGAAGAGG - Intergenic
1101231881 12:102749775-102749797 CTTAGTTCTCAGCAATGCAGTGG - Intergenic
1105587188 13:21756313-21756335 CTGACTTCACATCCATGCAGGGG + Intergenic
1110199903 13:72837262-72837284 CTAAGTGTAAACAAATGCAGAGG - Intronic
1110777434 13:79424819-79424841 CTGAGTGCAGATGAGTGCAGTGG - Intergenic
1112496470 13:99909532-99909554 CTGAGTCCACAGCACTGGAGTGG - Intergenic
1112497826 13:99918757-99918779 CTCAGTGCACATTTATGCAGAGG + Intergenic
1113448972 13:110392514-110392536 CTGAGTGGACACACAGGCAGAGG - Intronic
1114006121 14:18314974-18314996 CTGTATGCACACATATGCAGGGG - Intergenic
1122268957 14:100559796-100559818 CTGTGTGCGCATCTATGCAGAGG - Intronic
1124627719 15:31318522-31318544 CTCAGTGCCCCCCAATTCAGAGG - Intergenic
1129734981 15:77955067-77955089 CTGAGATCACACCATTGCACTGG + Intergenic
1130014993 15:80179711-80179733 CTAAGTCCACACCACAGCAGAGG - Intronic
1132673547 16:1112407-1112429 CTGAATGCAAACCACTGCTGAGG + Intergenic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133391749 16:5415933-5415955 CTGAGTCCACACACATGCAGAGG - Intergenic
1133770226 16:8863463-8863485 CTGAGTGCACACCAATGCAGTGG - Intronic
1135800402 16:25488990-25489012 GTGAGTGCACACCAGTGAAGTGG + Intergenic
1137892216 16:52174624-52174646 TTGGGTGCACACCCAGGCAGCGG - Intergenic
1142769566 17:2086849-2086871 CTGAGTGCTCACCAAGGGAGAGG + Intronic
1145344763 17:21982246-21982268 CCGAGTGCAAACCAATGGAATGG + Intergenic
1150856114 17:68754488-68754510 CTGAGTGGTCTCCAATGAAGTGG + Intergenic
1154531355 18:15349207-15349229 CTGTATGCACACATATGCAGGGG + Intergenic
1160199817 18:76787329-76787351 GTGAGTGAACACTGATGCAGGGG - Intergenic
1161715320 19:5873073-5873095 CTGAGATCACACCACTGCACAGG + Intronic
1163654540 19:18538163-18538185 CGGAGTGGACACCTTTGCAGGGG + Intronic
1166737991 19:45097431-45097453 CTGGGGGCACCCCAGTGCAGGGG + Intronic
925992726 2:9266599-9266621 CAGAGTTCACACCTCTGCAGAGG - Intronic
927919396 2:26960555-26960577 GAGAGTGCTCACCCATGCAGAGG + Intergenic
928144764 2:28763368-28763390 CTCAGTACACACCAAGTCAGTGG - Intronic
928313464 2:30229530-30229552 CTCAATGCACTCCAATGTAGAGG + Intergenic
930112398 2:47689748-47689770 TTGAGTGCCCACCTCTGCAGAGG + Intergenic
930690654 2:54360062-54360084 CTGAGGTGACACCAATGAAGAGG + Intronic
932020974 2:68086325-68086347 CTGAGAATACACAAATGCAGTGG + Intronic
932734823 2:74247255-74247277 CTGAGTGTAGGCCAATCCAGAGG + Exonic
935045490 2:99478184-99478206 CTGAGATCACACCACTGCACTGG + Intronic
938530453 2:132180487-132180509 CTGTATGCACACATATGCAGGGG + Intronic
938806582 2:134811782-134811804 CTGAGATCACACCACTGCACTGG + Intergenic
938959482 2:136328468-136328490 CTGAGAGCACACCAATTTAATGG + Intergenic
948046393 2:234948876-234948898 CTGAGTACACCCCAACACAGAGG + Intergenic
949020427 2:241738211-241738233 CTGAGTGCACACCATGGCCCAGG + Intronic
1174530399 20:51208225-51208247 CTGAGTTGACACCACTGCAAAGG - Intergenic
1176766001 21:13018944-13018966 CTGTATGCACACATATGCAGGGG - Intergenic
1177904341 21:26957667-26957689 CTGTGTGGACAGTAATGCAGTGG + Intronic
1180195131 21:46189591-46189613 TGGACTGCACACCAAGGCAGAGG + Exonic
1180430631 22:15245781-15245803 CTGTATGCACACATATGCAGGGG - Intergenic
1181138826 22:20788528-20788550 CTGAATCCACACCCAGGCAGGGG + Intronic
949102929 3:167698-167720 CAGATTGCAGACTAATGCAGTGG + Intergenic
949933301 3:9097563-9097585 CGGAATCCACACCAAAGCAGAGG - Intronic
950887439 3:16374034-16374056 CTGCGTGCACAACAATCCACAGG + Intronic
951720824 3:25695905-25695927 CTGAGTGCATGCCAATCCTGGGG - Intergenic
953767552 3:45755240-45755262 GTGAGACCGCACCAATGCAGTGG - Intergenic
954132732 3:48568593-48568615 CTGAGTGGCCACACATGCAGCGG - Intronic
963538006 3:146552347-146552369 CTGAGTTCAGACCAATACAATGG - Intergenic
964154204 3:153564690-153564712 TTGAGGCCACACCAATGCAAGGG - Intergenic
964312735 3:155411829-155411851 CTGAGACCACAGCATTGCAGAGG + Intronic
965890264 3:173504743-173504765 CTGAGAGATCACCAATGAAGAGG - Intronic
967885789 3:194332548-194332570 CTGAGTGAACAAAAAGGCAGAGG + Intergenic
971276822 4:25206146-25206168 CTAAGTTCAAACCAAAGCAGAGG - Intronic
973736402 4:53875793-53875815 CTGAGTGCTGACCCATGCACTGG - Intronic
975370001 4:73574155-73574177 CTGGGTGCACACTCATACAGAGG + Exonic
976262344 4:83157798-83157820 CTCAGTGCACGCCAGTGCAGTGG + Intergenic
976337770 4:83910646-83910668 CTGAGAGAACAACAAGGCAGTGG - Intergenic
978854040 4:113372769-113372791 CTGTTTGCAAACAAATGCAGTGG + Intronic
981341168 4:143623336-143623358 TTCAGAGCACACTAATGCAGGGG + Intronic
981548808 4:145921536-145921558 ATGAGTGTAAACCAAAGCAGTGG + Intronic
984910135 4:184666951-184666973 CTGAGTGCTTATCAAAGCAGGGG + Intronic
987020946 5:13870497-13870519 GTGAGTGCTCACCAAAGAAGAGG - Intronic
992494548 5:77280042-77280064 CTCAATGCACACCAACCCAGAGG - Intronic
992965006 5:81990686-81990708 CTCAGTGCTCATCATTGCAGTGG - Intronic
995950990 5:117713780-117713802 CTGAGTGCACTCACATCCAGTGG - Intergenic
996559538 5:124814047-124814069 CTGAGTGCACTGGAGTGCAGTGG - Intergenic
998633630 5:143928309-143928331 CCGAGGTCACACCACTGCAGAGG + Intergenic
999240932 5:150126996-150127018 CTGAGTCCACACCCTTGCTGGGG + Intronic
999474546 5:151886635-151886657 CTTGGTGGAGACCAATGCAGAGG + Intronic
1000155896 5:158551495-158551517 CTCAGTGCTCATCAATGAAGAGG - Intergenic
1000630434 5:163584826-163584848 CTAAGTGTCCACCAATGCAAGGG - Intergenic
1001558808 5:172655744-172655766 CTGAGCTCTCAGCAATGCAGAGG - Intronic
1001664415 5:173420812-173420834 ATGAATCCACAGCAATGCAGAGG + Intergenic
1002127339 5:177056182-177056204 CTGAGATCACACCACTGCACTGG + Intronic
1003048991 6:2763754-2763776 CGGAGTGGACGCCAAGGCAGAGG + Intergenic
1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG + Intergenic
1008336810 6:50316456-50316478 CTGACTGTACACCATAGCAGAGG - Intergenic
1008411282 6:51183015-51183037 ATGGGTGCACACCATTTCAGAGG - Intergenic
1008556938 6:52681580-52681602 CTGAGGGCACAGCAGTGCAGTGG - Intronic
1012464475 6:99502176-99502198 ATTAGTGCACACGAATGCATGGG + Intronic
1019641712 7:2106893-2106915 CTGAGTGCAGACCTGGGCAGGGG + Intronic
1021449127 7:20765234-20765256 CTGAGACCACACCACTGCACTGG + Intronic
1023123149 7:36929371-36929393 TGGAGTGCACACCAAAGCATTGG + Intronic
1026769657 7:73187452-73187474 CTGATTGCTGACAAATGCAGTGG - Intergenic
1027010526 7:74740838-74740860 CTGATTGCTGACAAATGCAGTGG - Intronic
1027077516 7:75205206-75205228 CTGATTGCTGACAAATGCAGTGG + Intergenic
1029666252 7:101996990-101997012 CGGAGTGCACACGAGCGCAGGGG - Intronic
1034967869 7:155402651-155402673 CTGACTGCAAGCCAAGGCAGGGG - Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035406040 7:158597992-158598014 CTGAGATCACACCACTGCACTGG + Intergenic
1035938692 8:3871991-3872013 CTCACTGCACACCATTGCATAGG - Intronic
1039622927 8:39016842-39016864 CAGAGTGCAAACCAAGGCAGAGG + Intronic
1041812905 8:61931758-61931780 CTGAATGCACACCCCTGCTGGGG - Intergenic
1047262218 8:123273846-123273868 CTGGGTCCTCACCAAGGCAGGGG + Intronic
1047907355 8:129486743-129486765 CAGAGTGCAAAACCATGCAGAGG + Intergenic
1048562248 8:135552976-135552998 GTGAGTGCACATATATGCAGCGG - Intronic
1049820051 8:144627979-144628001 CTGCATGCAGACCAATGCAGTGG + Intergenic
1050021615 9:1290522-1290544 GTGATTGCGCACCAATGCAAGGG + Intergenic
1052401427 9:28005186-28005208 CTGAGGTCATACCAATCCAGTGG + Intronic
1052493246 9:29193349-29193371 CTGAGTGGAGACAAATGGAGTGG - Intergenic
1053709063 9:40786975-40786997 CTGTATGCACACATATGCAGGGG + Intergenic
1054418972 9:64907776-64907798 CTGTATGCACACATATGCAGGGG + Intergenic
1056801897 9:89698065-89698087 CTGAGTCCATGCCCATGCAGAGG + Intergenic
1059462226 9:114439961-114439983 CTGAGATCACACCACTGCACTGG - Intronic
1190928213 X:54927295-54927317 CTGAGCGCACCCCACTGCAAGGG - Intronic
1191105014 X:56767365-56767387 CAGAGTGGACGCCAATGCCGAGG - Intergenic
1192558484 X:72109101-72109123 CGGAGTTCACACTAAAGCAGAGG - Intergenic
1192620247 X:72672160-72672182 CTGAGTGAACACTGAAGCAGGGG + Intronic
1194806359 X:98333235-98333257 CTGAATGCAAACCAAGACAGAGG - Intergenic
1195871196 X:109488221-109488243 CTGAATGCCCACCAATGGGGGGG + Intergenic
1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG + Intergenic
1196468727 X:116000243-116000265 CTGAGTGCTGAACAATTCAGGGG + Intergenic
1202073163 Y:21013621-21013643 ATGAGTGCACTCAGATGCAGTGG + Intergenic
1202077863 Y:21055475-21055497 ATGAGTGCACTCAGATGCAGTGG + Intergenic