ID: 1133770254

View in Genome Browser
Species Human (GRCh38)
Location 16:8863611-8863633
Sequence CCAGATGGGCCATGAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 277}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133770254_1133770261 -6 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770261 16:8863628-8863650 ATCTGGGCTGAAGCCAAGCTGGG 0: 1
1: 0
2: 2
3: 16
4: 197
1133770254_1133770265 8 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770265 16:8863642-8863664 CAAGCTGGGGTGGCCAGAGTAGG 0: 1
1: 0
2: 3
3: 30
4: 322
1133770254_1133770263 -2 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770263 16:8863632-8863654 GGGCTGAAGCCAAGCTGGGGTGG 0: 1
1: 0
2: 4
3: 38
4: 383
1133770254_1133770260 -7 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770260 16:8863627-8863649 CATCTGGGCTGAAGCCAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 190
1133770254_1133770266 13 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770266 16:8863647-8863669 TGGGGTGGCCAGAGTAGGCCTGG 0: 1
1: 0
2: 4
3: 30
4: 320
1133770254_1133770267 19 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770254_1133770262 -5 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770262 16:8863629-8863651 TCTGGGCTGAAGCCAAGCTGGGG 0: 1
1: 0
2: 0
3: 35
4: 300
1133770254_1133770268 20 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770268 16:8863654-8863676 GCCAGAGTAGGCCTGGCCAAGGG 0: 1
1: 0
2: 0
3: 26
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133770254 Original CRISPR CCAGATGGGCCATGAGAGGC TGG (reversed) Intronic