ID: 1133770257

View in Genome Browser
Species Human (GRCh38)
Location 16:8863615-8863637
Sequence CAGCCCAGATGGGCCATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133770257_1133770268 16 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770268 16:8863654-8863676 GCCAGAGTAGGCCTGGCCAAGGG 0: 1
1: 0
2: 0
3: 26
4: 189
1133770257_1133770267 15 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770257_1133770263 -6 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770263 16:8863632-8863654 GGGCTGAAGCCAAGCTGGGGTGG 0: 1
1: 0
2: 4
3: 38
4: 383
1133770257_1133770266 9 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770266 16:8863647-8863669 TGGGGTGGCCAGAGTAGGCCTGG 0: 1
1: 0
2: 4
3: 30
4: 320
1133770257_1133770261 -10 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770261 16:8863628-8863650 ATCTGGGCTGAAGCCAAGCTGGG 0: 1
1: 0
2: 2
3: 16
4: 197
1133770257_1133770262 -9 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770262 16:8863629-8863651 TCTGGGCTGAAGCCAAGCTGGGG 0: 1
1: 0
2: 0
3: 35
4: 300
1133770257_1133770265 4 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770265 16:8863642-8863664 CAAGCTGGGGTGGCCAGAGTAGG 0: 1
1: 0
2: 3
3: 30
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133770257 Original CRISPR CAGCCCAGATGGGCCATGAG AGG (reversed) Intronic