ID: 1133770259

View in Genome Browser
Species Human (GRCh38)
Location 16:8863626-8863648
Sequence CAGCTTGGCTTCAGCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 457}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133770259_1133770268 5 Left 1133770259 16:8863626-8863648 CCATCTGGGCTGAAGCCAAGCTG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1133770268 16:8863654-8863676 GCCAGAGTAGGCCTGGCCAAGGG 0: 1
1: 0
2: 0
3: 26
4: 189
1133770259_1133770267 4 Left 1133770259 16:8863626-8863648 CCATCTGGGCTGAAGCCAAGCTG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770259_1133770272 24 Left 1133770259 16:8863626-8863648 CCATCTGGGCTGAAGCCAAGCTG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1133770272 16:8863673-8863695 AGGGCCACTCACTCCCCAGTAGG 0: 1
1: 0
2: 2
3: 49
4: 3745
1133770259_1133770266 -2 Left 1133770259 16:8863626-8863648 CCATCTGGGCTGAAGCCAAGCTG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1133770266 16:8863647-8863669 TGGGGTGGCCAGAGTAGGCCTGG 0: 1
1: 0
2: 4
3: 30
4: 320
1133770259_1133770265 -7 Left 1133770259 16:8863626-8863648 CCATCTGGGCTGAAGCCAAGCTG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1133770265 16:8863642-8863664 CAAGCTGGGGTGGCCAGAGTAGG 0: 1
1: 0
2: 3
3: 30
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133770259 Original CRISPR CAGCTTGGCTTCAGCCCAGA TGG (reversed) Intronic