ID: 1133770267

View in Genome Browser
Species Human (GRCh38)
Location 16:8863653-8863675
Sequence GGCCAGAGTAGGCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133770258_1133770267 5 Left 1133770258 16:8863625-8863647 CCCATCTGGGCTGAAGCCAAGCT 0: 1
1: 0
2: 1
3: 10
4: 208
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770254_1133770267 19 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770259_1133770267 4 Left 1133770259 16:8863626-8863648 CCATCTGGGCTGAAGCCAAGCTG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770257_1133770267 15 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133770267 Original CRISPR GGCCAGAGTAGGCCTGGCCA AGG Intronic
901026442 1:6280966-6280988 GGTCAGAGTAGGGCTGGGCCTGG - Intronic
901053015 1:6435106-6435128 TTCCCGAGTAGGCCTGGCCCAGG - Intronic
901069473 1:6509937-6509959 GGCCACAGTGGGCCTTGCCTGGG - Intronic
901657405 1:10777326-10777348 GGTCAGAGGTGGCCTGGCCCAGG - Intronic
902761507 1:18583807-18583829 GGCCAGAGTGGGTCAGCCCAGGG - Intergenic
904801968 1:33099364-33099386 GGTCAGAGTAGGCCTCCCCAAGG + Intronic
904933387 1:34108495-34108517 AGCAAGAGTAGCCCTGTCCATGG + Intronic
905362728 1:37431445-37431467 GCCCTGGGGAGGCCTGGCCAAGG + Intergenic
906032712 1:42733984-42734006 GGCCAGAATGGAGCTGGCCAAGG + Exonic
906517998 1:46450840-46450862 GGCCACAGTGGGCCAGGCCAGGG + Intergenic
907048245 1:51313076-51313098 GAGCAGATTAGACCTGGCCAAGG - Intronic
907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG + Intronic
911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG + Intronic
912921164 1:113868710-113868732 GGCCAGGGTAGGACAGGACAGGG + Intronic
914244068 1:145872938-145872960 GGCCCTAGGAGGCCTGGCAAAGG - Exonic
916058493 1:161083751-161083773 GGCCCGTGGGGGCCTGGCCAGGG - Intronic
916344180 1:163769655-163769677 GGCCAAAGTAGTCCTGGACAAGG - Intergenic
917517208 1:175718263-175718285 GGTCAGAGAAGGCCAGGACAGGG - Intronic
919755106 1:201061761-201061783 CTCCAAAGTAGGCCTGACCAGGG - Intronic
920123844 1:203677949-203677971 GGACAGAGTAGGGCAGGGCAGGG + Intronic
920167469 1:204045868-204045890 GGCCACAGGACTCCTGGCCACGG - Intergenic
920206446 1:204295801-204295823 GGCCACAGCAGGCCAAGCCAAGG + Intronic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
1066197572 10:33116044-33116066 GCCCACCGTAGGGCTGGCCACGG - Intergenic
1066367754 10:34793240-34793262 GGGCAGAGTATCCCAGGCCAGGG + Intronic
1066435178 10:35391165-35391187 GGCCAGAGCACACCTGGACAGGG + Intronic
1066996643 10:42570359-42570381 GGACAGTGTAGGCCTGGGCCTGG - Intergenic
1067548876 10:47219242-47219264 GGCTTGAGCAGGCCTGGTCAGGG - Intergenic
1067558624 10:47289184-47289206 GGGAAGAGCAGGCATGGCCACGG + Intergenic
1067697612 10:48547358-48547380 GGCAATAGGAGGCCTGGACAGGG - Intronic
1067800235 10:49353638-49353660 GGCCAGAGGAGGGCTGGCCTAGG + Intergenic
1069571796 10:69498640-69498662 GCCCAGAGCAGGCCTGCACAAGG - Intronic
1070778449 10:79123840-79123862 GCTCACAGCAGGCCTGGCCAGGG + Intronic
1070830400 10:79414749-79414771 ATCCAGGGTGGGCCTGGCCAAGG - Intronic
1071531020 10:86390340-86390362 GGCCAGAGCCGGCCTGGACCAGG + Intergenic
1072722932 10:97791996-97792018 GGCCAGACTCGGCCAGGCTACGG + Intergenic
1073206240 10:101770881-101770903 GGCCAGAGCAGGCCAGGCTCTGG - Intronic
1073456167 10:103637990-103638012 GACCAGGGGAGGCCTGGCCGAGG - Intronic
1073718667 10:106139752-106139774 GGCTACAGAAGGCCTGGTCAAGG + Intergenic
1074756032 10:116624801-116624823 GCCCAGAGTCGGCTTGGACATGG + Intronic
1075132703 10:119754169-119754191 GGCCAGGGGACTCCTGGCCAGGG + Intronic
1075475406 10:122729589-122729611 GGCCAAAGTGGGCCTCTCCAGGG - Intergenic
1075480556 10:122777898-122777920 GGCCAAAGTGGGCCTTTCCAAGG - Intergenic
1075480806 10:122780221-122780243 GGCCAAAGTGGGCCTCGCCAGGG - Intergenic
1075619329 10:123914293-123914315 AGGCAGAGAAGGCCTGGTCAGGG - Intronic
1075872009 10:125777963-125777985 GGCCAGGCGAGGCCAGGCCACGG - Intergenic
1076225391 10:128770635-128770657 GGCCAGAGTAAGCCAGGACATGG + Intergenic
1076731008 10:132438843-132438865 GGCCAGAGCAGACCAGACCAGGG - Intergenic
1076909505 10:133379911-133379933 GGCCAGCGTGGGCGTGGCCCAGG + Intronic
1077094132 11:792234-792256 GGTCAGTGTGAGCCTGGCCAAGG + Intronic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1078354838 11:10625863-10625885 GGCCAGAGCTGCCCTGGCCAGGG + Intronic
1078693665 11:13607416-13607438 GACCAGAGTAGGCCTGACCGAGG + Intergenic
1079032318 11:16994792-16994814 GCACAGAGGAGGGCTGGCCAGGG - Intronic
1080447897 11:32353989-32354011 GGCCAGAGCTGGACTGGCCCTGG + Intergenic
1082001354 11:47395162-47395184 GGCCAAAGTAGGCCTGGCCCTGG - Intergenic
1083275606 11:61595417-61595439 GGCCAGTGTGGTCCTGGCCTTGG - Intergenic
1083340979 11:61958208-61958230 GGCCAGGGTAGGCCTTGGCTGGG - Exonic
1083471864 11:62889432-62889454 GGCCAAAGGAGGCCTCACCACGG + Intergenic
1083596528 11:63920497-63920519 GGCCACTGATGGCCTGGCCAGGG - Intergenic
1083694474 11:64433475-64433497 CTCCAGAGTGAGCCTGGCCATGG + Intergenic
1084067091 11:66710867-66710889 GGCCAGAGGAGGCCCGGCTGAGG - Intronic
1085217953 11:74848810-74848832 GGCCAGAGTACGTATGGTCAGGG - Intronic
1086561519 11:88174921-88174943 GCCCAGAGCAGGCCTCCCCAGGG - Intronic
1088442537 11:109887765-109887787 GGCCAGGGTAGGAGTGGTCAAGG + Intergenic
1089075895 11:115738161-115738183 GGACAGAGCTGGGCTGGCCATGG - Intergenic
1089347802 11:117802271-117802293 GACCAGAGGAGGCCTGGTCAGGG - Intronic
1089868433 11:121651829-121651851 GGTCAGAGCAGGCCTGGGGAAGG + Intergenic
1089977759 11:122747111-122747133 GGCCAGCACAGGCATGGCCAAGG + Intronic
1090807763 11:130213075-130213097 GGTCTGAGTAGGACTCGCCATGG - Intergenic
1091197512 11:133744600-133744622 GGCTTGAGTGGGCCCGGCCACGG + Intergenic
1091634009 12:2183700-2183722 GGGCAGAGCAGGGCTGGCCCTGG - Intronic
1092429402 12:8396902-8396924 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1094687312 12:32730409-32730431 AGCAAGAGTAGGGCTGGGCACGG + Intronic
1098827108 12:75310329-75310351 GGCCAAAGTAGGCCTCACCAAGG + Intronic
1102756739 12:115347759-115347781 GGCCAGAATAGGCCTCCCCGAGG + Intergenic
1103575370 12:121873422-121873444 GGCCCCGGTAGGGCTGGCCAAGG + Intergenic
1108072701 13:46644741-46644763 CCCCAGTGTAGGCCTGGGCATGG + Intronic
1108750888 13:53447256-53447278 GGCCAGAGTATTCCTGCCCCTGG - Intergenic
1110296873 13:73877911-73877933 GGCCAGAGTAGTCTTGGAAAAGG - Intronic
1112302999 13:98247350-98247372 GGCCAAAGTGGGCCCAGCCAGGG - Intronic
1114676050 14:24440997-24441019 GGCCAGAGAAGGTGAGGCCAAGG - Exonic
1115378202 14:32702731-32702753 GGCCAGAGCCAGCCAGGCCAGGG - Intronic
1116492967 14:45527360-45527382 TCCCAGAGTAGACCTGGCGAGGG + Intergenic
1117130733 14:52684200-52684222 GGCCATAGTTGACCTGACCAAGG + Intronic
1117253492 14:53956352-53956374 GGACAGAGAAGGCCTGGGCAGGG + Intronic
1119640036 14:76308047-76308069 GGCCAGAGCACGCCTTGCCGTGG + Intergenic
1121022393 14:90588226-90588248 GGCCAGGCCAGGCCAGGCCAGGG + Intronic
1121051185 14:90819919-90819941 TGCCAGAGTGGCCCGGGCCATGG - Intergenic
1121465333 14:94111943-94111965 GGCCAGAGTCTGCCTGCCCCGGG - Intronic
1122145145 14:99684388-99684410 GGGCAGGGCAGGCCAGGCCAGGG - Exonic
1122227222 14:100286797-100286819 AACCAGAGGGGGCCTGGCCAGGG - Intergenic
1122890991 14:104732171-104732193 GGCCAGGGTCTGCCTTGCCATGG - Intronic
1122904623 14:104795959-104795981 GGCCAGAGAGGGCGTGGCCCCGG - Intergenic
1123421315 15:20139594-20139616 GGCCAGAGTATGGCAGGGCAGGG + Intergenic
1123443814 15:20307197-20307219 GGCCAGAGTATGGCAGGGCAGGG - Intergenic
1123530541 15:21146134-21146156 GGCCAGAGTATGGCAGGGCAGGG + Intergenic
1124405757 15:29390077-29390099 GGCCAGAGCTGGCCTCTCCAGGG - Intronic
1125606201 15:40941351-40941373 GGCCAGGGTCAGCCTGGTCAGGG + Intergenic
1127089949 15:55457222-55457244 GGCCAGAGTGAGACTGGCCTTGG + Intronic
1128497160 15:68205211-68205233 GGTCTGTGTCGGCCTGGCCAGGG - Intronic
1128560912 15:68667164-68667186 GGGCAGAGTGGGCCAAGCCATGG - Intronic
1128638181 15:69316613-69316635 GGCCAGAGAAGGCATGTCCCTGG + Intronic
1128773523 15:70301607-70301629 GGCCAGGGTGGGGCTGCCCAGGG - Intergenic
1129293612 15:74587259-74587281 GGCCAGAGAGGGCCTGGACCAGG + Intronic
1131055205 15:89370870-89370892 GGCCAGAGGAGGCTTGGGGAAGG - Intergenic
1131461650 15:92622027-92622049 CGCCAGAGCAGATCTGGCCACGG + Intronic
1132498880 16:276002-276024 GGCCAGAGTCGCCCAGGCCCCGG + Intronic
1132570993 16:643917-643939 GGCTAGAGGAGCCCTGGGCAGGG + Intronic
1132661369 16:1062934-1062956 GACCACAGGAGGCCTGGCCTGGG - Intergenic
1132685027 16:1158652-1158674 GCCCAGAGCAGGCCGGGCCCTGG + Intronic
1133033804 16:3023812-3023834 GACCAGGGTGGGCCTGACCAAGG - Intronic
1133116412 16:3580256-3580278 GGCCAGGGGAGGCATGGCCTGGG - Intergenic
1133342208 16:5044182-5044204 GCCCTGAGTAGGCAAGGCCAGGG - Exonic
1133369899 16:5239603-5239625 GGCCGGAGCGGGTCTGGCCACGG + Intergenic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1135120456 16:19761858-19761880 GTCCAGAGTAGGGCAGGCCCAGG + Intronic
1135323489 16:21512052-21512074 GGCCAGGCAAGGCCTGCCCATGG + Intergenic
1136718092 16:32301155-32301177 GGCCAGAGTAGGGCTGGGACAGG + Intergenic
1136783920 16:32923709-32923731 GGCCAGAGAAGGCCTCGCTGAGG + Intergenic
1136885863 16:33930097-33930119 GGCCAGAGAAGGCCTCGCTGAGG - Intergenic
1137262419 16:46842645-46842667 GGCCATAGGTGGCCTGGCCCTGG + Intergenic
1138607527 16:58098502-58098524 GGGTGGAGTAGGCCTGTCCAAGG - Intergenic
1139529328 16:67535257-67535279 GGGCAGTGAGGGCCTGGCCAAGG + Intronic
1140447778 16:75045221-75045243 GACCAGAATAACCCTGGCCAGGG + Intronic
1141573449 16:84948598-84948620 GACCGGAGGAAGCCTGGCCAGGG - Intergenic
1142035690 16:87861136-87861158 GGCCAGGCAAGGCCTGCCCATGG + Intronic
1142263236 16:89052138-89052160 GGGCAGAGGAGACCTGGCCCTGG + Intergenic
1203008336 16_KI270728v1_random:216610-216632 GGCCAGAGTAGGGCTGGGACAGG - Intergenic
1203146650 16_KI270728v1_random:1807726-1807748 GGCCAGAGCAGGCCTGGGACAGG + Intergenic
1143403442 17:6660459-6660481 GGCCAGACTAAGCCAGGCTAAGG + Intergenic
1143473560 17:7190853-7190875 GGCCAGAGGACACCTGGCCAAGG + Intronic
1144750103 17:17642641-17642663 GGTCAGAGAAGGCCTTACCAAGG - Intergenic
1145246591 17:21273680-21273702 GGCCAGAGTCCTCCTGGCCCGGG + Intergenic
1146824001 17:36007961-36007983 GGCCAGAGTAGTCTTGGAAAAGG - Intergenic
1147181813 17:38691252-38691274 GGCCAGAGGAGACCTGGAAAAGG + Intergenic
1147625167 17:41895499-41895521 GGCCAGAGGAGGCCTGGTGTAGG - Intronic
1149610088 17:57953694-57953716 GGCCCTAGTTGGCCTGGCCCAGG + Intronic
1151547983 17:74805157-74805179 GACCAGAGTAGGCCTCTCCCCGG - Intronic
1151556186 17:74847836-74847858 GGCAAGAGTAAGCCTTGCCTGGG - Exonic
1151824717 17:76517865-76517887 GGACAGTGTTGGACTGGCCAGGG - Intergenic
1152463307 17:80452385-80452407 GGCCACAGATGTCCTGGCCATGG + Intergenic
1152637934 17:81437816-81437838 AGCCGGAAGAGGCCTGGCCATGG + Intronic
1156904053 18:42333558-42333580 GGGCAGAGTGGGGCTGGGCATGG - Intergenic
1159963346 18:74572914-74572936 GGCCTCAGTAGTCCAGGCCATGG + Intronic
1160783477 19:889026-889048 GTTAAGAGTAGGCGTGGCCAGGG - Intronic
1160783488 19:889061-889083 GTTAAGAGTAGGCGTGGCCAGGG - Intronic
1160783504 19:889126-889148 GTTAAGAGTAGGCGTGGCCAGGG - Intronic
1160783526 19:889195-889217 GGTAAGAGTAGGCGTGGCCAGGG - Intronic
1161054163 19:2181577-2181599 GGCCAGGGTGGGCCTGACCCAGG + Intronic
1161872664 19:6882355-6882377 GGCCAGAGGAGGCCTGACCCAGG - Intergenic
1162050367 19:8029004-8029026 GGCCAGAGTGGGCCAGGCCTAGG + Intronic
1162951772 19:14075217-14075239 GGCCAGACACGGCCTGGCCCAGG + Intergenic
1163006715 19:14401570-14401592 GGGCAGGGCAGGCCAGGCCAAGG - Intronic
1164434703 19:28219330-28219352 GGCCAGAGGAGGACCAGCCATGG + Intergenic
1165323121 19:35098653-35098675 GGGCAGAGGAGGACTAGCCAAGG + Intergenic
1165938222 19:39402616-39402638 GGCCTGAGCGGGCGTGGCCAAGG - Intergenic
1166336025 19:42108049-42108071 GGCCAGAGAAGGCCTCTCTAGGG - Intronic
1166673273 19:44724169-44724191 GGCCCCAGGATGCCTGGCCAGGG - Intergenic
1166676564 19:44745016-44745038 GGAGAGAGTAGGGCTGGTCAGGG - Intergenic
1166861342 19:45813321-45813343 GGTCAGTGAAGGCCTGTCCAAGG - Intronic
1167538761 19:50072279-50072301 GGCAAGACGAGGCCTGGGCAGGG + Intergenic
1168153433 19:54460850-54460872 GGCCCGTGTAGGCCAGGCCCAGG - Exonic
1168403827 19:56100620-56100642 GGCGGGTGTTGGCCTGGCCATGG - Intronic
1168403916 19:56100988-56101010 GGCGGGGGTTGGCCTGGCCATGG - Intronic
1168403956 19:56101158-56101180 GGCGGGGGTTGGCCTGGCCATGG - Intronic
927199572 2:20569980-20570002 GGCCAGAAAAGCCCTGGGCAGGG - Intronic
927633417 2:24793615-24793637 GACCAGAGTAGCCGTGGCCTCGG + Intronic
927965643 2:27265975-27265997 GGCCAGAGAAGGCCTCCCCGAGG - Intronic
928167449 2:28981411-28981433 GGCCAGGGTGGGCCAGGCCTGGG + Exonic
928212618 2:29334746-29334768 GGACAGAGAAGGCCGTGCCAGGG - Intronic
933633551 2:84682622-84682644 GGCCGGGGTATGCATGGCCAAGG - Intronic
935801891 2:106705980-106706002 GGCAAGAGTAGGACTTGCAATGG - Intergenic
936045663 2:109185954-109185976 GGCCAGCAGAGGCCTGGCCTTGG + Intronic
936091791 2:109506317-109506339 TCCCAGCATAGGCCTGGCCATGG - Intergenic
936907422 2:117553307-117553329 GACCAAAGTAGGCCTGTACAAGG - Intergenic
937037419 2:118793537-118793559 GGCCACTGTAACCCTGGCCATGG - Intergenic
937122918 2:119453085-119453107 GGACAGTGCAGGCATGGCCAAGG + Intronic
937125629 2:119473492-119473514 GGCCAGATTAGGCCTGGGGAAGG + Exonic
938339583 2:130526729-130526751 GGGCAGGGCAGGCCTGGTCAGGG + Intronic
938350253 2:130594021-130594043 GGGCAGGGCAGGCCTGGTCAGGG - Intronic
940908354 2:159188739-159188761 GACCAGAAGAGGCTTGGCCAGGG - Intronic
944132622 2:196363125-196363147 GTCCAGAAGAGGCCTGGACAGGG - Intronic
946540928 2:220683966-220683988 GGACAGAGATGGCATGGCCAGGG + Intergenic
947816285 2:233039833-233039855 GACCAGAGTAGTCCCGGACAAGG - Intergenic
947983245 2:234427419-234427441 GGCCAGAGCTGGAGTGGCCAAGG + Intergenic
948454601 2:238098968-238098990 GAGCAGAGCAGGCCTGGCCGAGG - Exonic
949031174 2:241798202-241798224 GGCCTGAGGAGGCCTGGCCTGGG - Intronic
949047753 2:241879870-241879892 GGCCATAGGATGCCTGGCCCTGG - Intergenic
1168844456 20:934395-934417 GGCCACGGTAGGCGAGGCCAGGG - Intergenic
1169192411 20:3666626-3666648 GGGCAGAGTTGGCCTCCCCAGGG + Intergenic
1169244637 20:4015729-4015751 GGCCGCACCAGGCCTGGCCAGGG - Intergenic
1172062579 20:32196625-32196647 GGCCACAGGAGGCCTGGTCATGG - Exonic
1172094777 20:32455281-32455303 GGCCAGAGCAGGCTTTGCCTGGG - Intronic
1172327169 20:34045320-34045342 GGCCAGAGTAGACCTCTCTAAGG + Intronic
1172370513 20:34386394-34386416 TGACAGAGTAGCCCTGTCCAAGG + Intronic
1173017000 20:39234773-39234795 GGTCATGGGAGGCCTGGCCAGGG + Intergenic
1175183155 20:57162467-57162489 CCCCAGACTAGGGCTGGCCAGGG + Intergenic
1175692458 20:61075456-61075478 GTCCAAAGGATGCCTGGCCAGGG - Intergenic
1175946987 20:62563565-62563587 GGTCAGAGCAGGCCTGGCAGAGG + Intronic
1176030345 20:63008499-63008521 GGCCGGAGGAGGCCTGGCACAGG + Intergenic
1178872006 21:36385248-36385270 GGCCAGAGCAGGACTCGCCTTGG + Intronic
1179222963 21:39425919-39425941 GGCCACAGGAGCTCTGGCCAAGG + Intronic
1179600806 21:42476197-42476219 GCCCAGCCTAGGCCTGGCCAGGG + Intronic
1179610524 21:42547400-42547422 CTCCTGAGGAGGCCTGGCCAGGG - Intronic
1181041629 22:20195139-20195161 GGCCATACAGGGCCTGGCCAGGG - Intergenic
1181286053 22:21753463-21753485 CGGCAGTGGAGGCCTGGCCAGGG + Intergenic
1181305743 22:21916379-21916401 GGCCAGAGTCTGCCTGGGGAAGG - Intergenic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1183078501 22:35441649-35441671 GGGCAGAGGAGGACTGGGCAAGG + Intergenic
1183613259 22:38925605-38925627 GGCATGAGTAGGCCTGGGCACGG - Intergenic
1184089224 22:42283671-42283693 GGCCAGGGCAGGGCTGGGCAGGG - Intronic
1184089480 22:42284708-42284730 AGCAAGAGGAGGCCTGGCCTGGG + Intronic
1184301521 22:43563502-43563524 GGCAAGATCAGGCCTCGCCATGG - Intronic
1184415667 22:44350535-44350557 TCCCAGAGTTGGCCTGGCCGAGG + Intergenic
950004073 3:9680143-9680165 GTCCAGAGTAGAGTTGGCCATGG + Intronic
950151168 3:10688670-10688692 GGCCATAGGAGGCCTGGCGCAGG - Intronic
950813603 3:15674444-15674466 GGGGAGAGTAGGTCTGGCAAGGG + Intronic
952892016 3:38049626-38049648 GGCCAGAGCAGGCTTTTCCAAGG + Intronic
953579208 3:44138242-44138264 GGCCCGAGCAGCCCTAGCCATGG + Intergenic
954327218 3:49870065-49870087 GGCCTGCTTAGCCCTGGCCAAGG + Exonic
954456281 3:50601405-50601427 GGGCAGAGAAGGCCTGGCGTGGG - Intergenic
955269889 3:57486915-57486937 GGCCAGAGAAGGCCTTTCTAGGG + Intronic
956413741 3:69005410-69005432 GGCAAAAGTATGCTTGGCCAGGG - Intronic
957073021 3:75580461-75580483 GGCCGGAGCGGGCCTGGCCACGG - Intergenic
958891711 3:99790871-99790893 GGCCAAAGATGGCCTTGCCATGG + Exonic
960043419 3:113173299-113173321 GGCCAGAGCAGGCCGGGGCAGGG + Intergenic
961449369 3:126995500-126995522 GACCAGAGCAGGGCTGGCCTCGG - Intronic
961873327 3:130003269-130003291 GGCCGGAGCGGGCCTGGCTACGG - Intergenic
962346519 3:134623174-134623196 GGCCAGAGCAAGCCAGGCCCAGG - Intronic
963114377 3:141713905-141713927 GGACTCAGTAGGCCTGGACAGGG - Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
967921725 3:194619091-194619113 GGCCAGAGTGGGGCTGGGCCTGG + Intronic
968519952 4:1030733-1030755 GGCCTGAGTGGGTGTGGCCAAGG + Intergenic
968599993 4:1504249-1504271 GGCCACAGGAGGCCTGGACCTGG + Intergenic
968646036 4:1741082-1741104 GGCAAGGGGAGGCTTGGCCAAGG - Intronic
968658381 4:1788403-1788425 GGGCAGTGGAGGGCTGGCCAGGG - Intergenic
968733106 4:2280981-2281003 GGCCAGCCTTGGCCTGGCCTCGG - Intronic
968750732 4:2387559-2387581 GCACAGAGGAGGCCTGGGCAGGG + Intronic
969016625 4:4107758-4107780 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
969476174 4:7423656-7423678 GGCCAGGGTAGGGCTGGTCCTGG - Intronic
969636045 4:8370093-8370115 GGCCAGAGAAGGCCTCTCCAAGG + Intronic
969796536 4:9532145-9532167 GGCCGGAGCGGGCCTGGCCACGG + Intergenic
973970673 4:56211331-56211353 GGCCAAGCTAGGCCTGGGCAGGG - Intronic
974664544 4:64940827-64940849 GGCCAAATTTAGCCTGGCCAAGG + Intergenic
976367241 4:84245296-84245318 GGCCACGGGAGGCCTGGTCATGG + Intergenic
986211964 5:5682455-5682477 GGGCTGAGGAGGCCTGGACAGGG + Intergenic
986673746 5:10166179-10166201 GCCTACAGTAGGCTTGGCCAGGG + Intergenic
986821325 5:11469923-11469945 GGCCAGAGGAGGCATGGTCAAGG - Intronic
987134443 5:14887744-14887766 CTCCAGAGTAGCCCTGGGCATGG - Intergenic
989090986 5:37731080-37731102 GGTCAGAGTTGTCCTGGTCAGGG + Intronic
990316342 5:54586360-54586382 GGACAGAGCAGAGCTGGCCATGG + Intergenic
990848129 5:60168025-60168047 GGCCACAGTAGTCTTGGACAGGG - Intronic
995059271 5:107796092-107796114 GGGAAGAGTAGTCCAGGCCATGG + Intergenic
997211299 5:132078566-132078588 GGTCAGAGCAGGACTGGTCATGG + Intergenic
997243029 5:132322035-132322057 GCCCAGAGCAGGCATGGTCAGGG - Intronic
997879835 5:137579719-137579741 GGTCAGAGAAGGCCTCCCCAGGG + Intronic
999243711 5:150142038-150142060 GGGAGGAGGAGGCCTGGCCATGG + Intronic
999721823 5:154404190-154404212 GGCCGGAGTCAGCCTGGCCCGGG + Exonic
1002026750 5:176400971-176400993 GGCCAGGGCAGGCCAGGACAGGG + Intronic
1002259247 5:177982598-177982620 GGTCAGAGCAGCCCTGGCCTGGG - Intergenic
1002921311 6:1575289-1575311 CTACAGAGGAGGCCTGGCCAGGG - Intergenic
1002941053 6:1716593-1716615 CGTGAGAGAAGGCCTGGCCAGGG + Intronic
1003016941 6:2475572-2475594 GGGCACAGAGGGCCTGGCCAAGG - Intergenic
1003565247 6:7216856-7216878 GGACAGGGTAGTCCTGACCAAGG - Intronic
1003590305 6:7431795-7431817 GGCCAGGGCAGGGCTGGCCCAGG - Intergenic
1004208931 6:13617890-13617912 AGCCAGCATGGGCCTGGCCAAGG + Intronic
1005379566 6:25219122-25219144 GGCCACACTAGGCATGGCCCAGG + Intergenic
1005823293 6:29615776-29615798 AGCCAGACTTGGCCTGGGCACGG + Intronic
1006811078 6:36821062-36821084 GGCCAGAGGAGGCCTCCACAGGG + Intronic
1006826210 6:36938140-36938162 AACAAGAGTAGGCCTGGCCAGGG - Intergenic
1007777149 6:44230185-44230207 GGCCTGAGTGGGCCTGGACCAGG + Intronic
1011359009 6:86501926-86501948 GGCCAAAGCAGGCCTGACTAAGG + Intergenic
1011850356 6:91620115-91620137 GGCCAGCCCAGCCCTGGCCATGG + Intergenic
1012974733 6:105768239-105768261 GGTCTGAGAAGGACTGGCCAGGG - Intergenic
1014474802 6:121859234-121859256 GGCCACAGTGAGCCTGGACAAGG - Intergenic
1017017878 6:150116280-150116302 GGCCAGAGAAGTCCAGGCCCAGG - Intergenic
1018065348 6:160121892-160121914 GCCCAGAGCAGGTCTGGCCACGG + Exonic
1018220116 6:161569645-161569667 GGGGAGAGAAAGCCTGGCCAGGG - Intronic
1018866271 6:167748845-167748867 GAGCAGAGCTGGCCTGGCCAGGG + Intergenic
1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG + Intergenic
1019287494 7:231069-231091 GGCCAGGGTGGTCCAGGCCAGGG + Intronic
1019722278 7:2580179-2580201 TGCCTGAGGAGGCCTGGCCAAGG + Intronic
1019742368 7:2681180-2681202 GGCTAGCGTGCGCCTGGCCATGG + Intronic
1020018123 7:4843560-4843582 GCCCAGAGTCAGGCTGGCCATGG - Intronic
1020109111 7:5438165-5438187 GGCCAGGACAGGGCTGGCCAGGG + Intronic
1022489611 7:30806616-30806638 GGGCACAGGAGCCCTGGCCATGG - Intronic
1023620563 7:42067676-42067698 GGCCATACTAGACTTGGCCATGG + Intronic
1024020622 7:45364546-45364568 GGCCAGAGAAGGACTAGCCCAGG - Intergenic
1024241315 7:47438649-47438671 TGCCAGAGCAGCCCTGGCCCAGG - Intronic
1024267052 7:47614820-47614842 GGCCAGAGGAGGACTGGCAGGGG - Intergenic
1026248756 7:68648054-68648076 GGCCTGAATAGGCATGGGCATGG + Intergenic
1026982766 7:74536304-74536326 GCCCAGAGCAGGGCTGGCCGCGG - Intronic
1027249507 7:76390199-76390221 GGCCAAAGTGAGCCTCGCCAGGG + Exonic
1027419392 7:78004926-78004948 GGCTTGAGGAGGCCTGGCCCTGG - Intergenic
1028730036 7:94136074-94136096 TGCCAGGCTAGTCCTGGCCATGG + Intergenic
1029075100 7:97928558-97928580 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1029123552 7:98283191-98283213 GGGCAGAGTTGGCCGGGACAGGG + Intronic
1029125920 7:98295188-98295210 TCCCAGAGGAGGCCTGGCCTGGG - Intronic
1029462717 7:100705707-100705729 GGTCAGAAGAGGCCTGGGCAGGG - Intergenic
1029573338 7:101386222-101386244 GACCAGAGGAGGCCTGCTCAGGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033075377 7:138245141-138245163 GGCCAGTGTAGCCATGGCTAAGG - Intergenic
1034078669 7:148256844-148256866 GGCCAGAGGTGGCCTAGCCTAGG - Intronic
1034420850 7:150989847-150989869 GGTCAGAGTAGGCCTGGATTGGG - Intergenic
1034962731 7:155372662-155372684 GGCCGGAGTGGGCGCGGCCAGGG + Intergenic
1035314338 7:157988802-157988824 GCCCAGAGCAGCCCTGCCCAGGG - Intronic
1036242431 8:7091820-7091842 GGCCAGAGCGGGCCTGGCCACGG + Intergenic
1036258363 8:7222192-7222214 TGCCAGAGAGGGCCTGTCCATGG - Intergenic
1036259424 8:7228336-7228358 TGCCAGAGCGGGCCTGTCCATGG - Intergenic
1036307201 8:7611188-7611210 TGCCAGAGCGGGCCTGTCCATGG + Intergenic
1036310417 8:7680788-7680810 TGCCAGAGCGGGCCTGTCCATGG - Intergenic
1036311466 8:7686906-7686928 TGCCAGAGCGGGCCTGTCCATGG - Intergenic
1036358043 8:8059175-8059197 TGCCAGAGCGGGCCTGTCCATGG + Intergenic
1036704245 8:11034797-11034819 GCACAGAGCAGACCTGGCCATGG - Intronic
1036765906 8:11549199-11549221 GGCCAGAGTGGGACTGACCAGGG + Intronic
1036892904 8:12607771-12607793 TGCCAGAGCGGGCCTGTCCATGG - Intergenic
1036899386 8:12659610-12659632 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1036900453 8:12665757-12665779 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1037797450 8:22008423-22008445 GGCTAGGGTTGGCCTGGACAGGG - Intergenic
1037835753 8:22213902-22213924 GTCCAGGGTAGGCCCAGCCAGGG + Intergenic
1038052386 8:23826161-23826183 GACCACATGAGGCCTGGCCAAGG - Intergenic
1038220771 8:25604893-25604915 GGGCAAAGTAAGGCTGGCCAGGG + Intergenic
1038411068 8:27360400-27360422 GCTCAGAGGAGGCCTGGCCTGGG + Intronic
1038433862 8:27521032-27521054 GGGCAGAGTGGGCATGGGCAGGG + Intronic
1039413956 8:37377978-37378000 GGCCAGACTAGGCCTCGATAAGG + Intergenic
1039440840 8:37594349-37594371 TCCCAGAGTAGGCCTGGCCTTGG - Intergenic
1039442437 8:37604666-37604688 GGCCACAGGAAGCCAGGCCAGGG + Intergenic
1042306651 8:67340443-67340465 GACCAGAGCGGGCCTGGCCCAGG + Intronic
1045343734 8:101275985-101276007 GGCCAGTGGCGGCCTGGCCTAGG + Intergenic
1045393085 8:101734304-101734326 GGTCAGAGAAGGCCTCCCCAAGG - Intronic
1047734595 8:127754298-127754320 GGCCTGAGTAGACCTGGTGAGGG - Intergenic
1049221575 8:141431105-141431127 GGGCAGAGCAGGGCTGGGCAGGG - Exonic
1049370124 8:142260427-142260449 GGACAGAGGACGCCTGGCCAGGG - Intronic
1049571328 8:143371567-143371589 GGCCAGAGTGGGGCTGACCTGGG - Intronic
1053005971 9:34604873-34604895 GGCCAGAGTAGGCCTCATGAAGG + Intergenic
1055281299 9:74677292-74677314 GCCCAAAGTAGTGCTGGCCACGG - Intronic
1055492235 9:76817274-76817296 GGCTAGAATAGGACTGGCCTGGG + Intronic
1055594154 9:77848570-77848592 TTCCAGAGTTGGCTTGGCCAGGG + Intronic
1056708536 9:88971611-88971633 GGCCTGGGGAGGCCTGGCCTGGG - Intergenic
1056799192 9:89679761-89679783 GTCCAGAGCAGCCCTGGCCCAGG + Intergenic
1057164719 9:92916551-92916573 GGCCAGACTACGCCAGGCTAAGG + Intergenic
1057229233 9:93308805-93308827 GGCCAGGCCAGGCCAGGCCAGGG + Intronic
1057318278 9:93986639-93986661 GGCAAGAGCACGCCTGGACAAGG - Intergenic
1059832195 9:118109696-118109718 AGCAAGAGTAGGCCTGCCCAGGG - Intergenic
1060197406 9:121632566-121632588 GGCCAGAGGAGGCCTTGCTAAGG - Intronic
1060822212 9:126668027-126668049 GGACAGAGCAGGGCTGGCCAGGG + Intronic
1061452914 9:130678301-130678323 GGACAGAGATGGCCTGGGCAGGG + Intronic
1061577708 9:131517847-131517869 GGCATGAGGAGGCCTGGCCGCGG - Intronic
1061670798 9:132187134-132187156 GGCCACAGTGGGCATGGCCTGGG - Intronic
1061869624 9:133513780-133513802 GGCCAGAGTGGGCTGGGCCAGGG + Intergenic
1062033485 9:134372428-134372450 GGCTGGAGGAGGCCTGGCCCTGG + Intronic
1062170092 9:135129897-135129919 TCCCAGAGCAGGCCTGGCCCAGG - Intergenic
1062262085 9:135667796-135667818 CCCCAGAGGAGGCCTGGGCATGG + Intergenic
1188499396 X:30809134-30809156 TGCCAGAGCAGCCCTGGCCCGGG - Intergenic
1192229561 X:69255802-69255824 GGCCAGAGAAGGGCTGGGAAAGG + Intergenic
1195217055 X:102712730-102712752 GACCGGAGCGGGCCTGGCCAAGG + Intronic