ID: 1133770267

View in Genome Browser
Species Human (GRCh38)
Location 16:8863653-8863675
Sequence GGCCAGAGTAGGCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133770259_1133770267 4 Left 1133770259 16:8863626-8863648 CCATCTGGGCTGAAGCCAAGCTG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770258_1133770267 5 Left 1133770258 16:8863625-8863647 CCCATCTGGGCTGAAGCCAAGCT 0: 1
1: 0
2: 1
3: 10
4: 208
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770257_1133770267 15 Left 1133770257 16:8863615-8863637 CCTCTCATGGCCCATCTGGGCTG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310
1133770254_1133770267 19 Left 1133770254 16:8863611-8863633 CCAGCCTCTCATGGCCCATCTGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133770267 Original CRISPR GGCCAGAGTAGGCCTGGCCA AGG Intronic