ID: 1133771093

View in Genome Browser
Species Human (GRCh38)
Location 16:8867650-8867672
Sequence AAGAGGCGCAGAGCCCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133771093_1133771096 -9 Left 1133771093 16:8867650-8867672 CCCAGCCGGGCTCTGCGCCTCTT 0: 1
1: 0
2: 2
3: 8
4: 167
Right 1133771096 16:8867664-8867686 GCGCCTCTTTCTTGCCCTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 109
1133771093_1133771103 25 Left 1133771093 16:8867650-8867672 CCCAGCCGGGCTCTGCGCCTCTT 0: 1
1: 0
2: 2
3: 8
4: 167
Right 1133771103 16:8867698-8867720 AGAACTCACGGTCATCACCGAGG 0: 1
1: 0
2: 0
3: 7
4: 45
1133771093_1133771101 13 Left 1133771093 16:8867650-8867672 CCCAGCCGGGCTCTGCGCCTCTT 0: 1
1: 0
2: 2
3: 8
4: 167
Right 1133771101 16:8867686-8867708 GGACCAGCATCGAGAACTCACGG 0: 1
1: 0
2: 2
3: 35
4: 96
1133771093_1133771097 -8 Left 1133771093 16:8867650-8867672 CCCAGCCGGGCTCTGCGCCTCTT 0: 1
1: 0
2: 2
3: 8
4: 167
Right 1133771097 16:8867665-8867687 CGCCTCTTTCTTGCCCTGAAGGG 0: 1
1: 0
2: 1
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133771093 Original CRISPR AAGAGGCGCAGAGCCCGGCT GGG (reversed) Intronic
900095476 1:938387-938409 CAGAAGCCCAGAGCCTGGCTGGG + Intronic
900888633 1:5432944-5432966 ATGAGGCCCTGAGCCAGGCTGGG - Intergenic
901818080 1:11806197-11806219 GTGAGGCGCAGATCCTGGCTGGG + Exonic
902570188 1:17342185-17342207 AAGGGGTACAGAGCCCAGCTGGG + Intronic
902636024 1:17735659-17735681 AAGAGGCTCACAGCCCTGTTTGG - Intergenic
902916493 1:19643222-19643244 AGGAGGCGCAGATGCAGGCTGGG + Exonic
903383202 1:22910599-22910621 AAGAGGGGCAGGGCCTGGCTGGG - Intronic
907843938 1:58186315-58186337 AAGAGGCAGAGAACCAGGCTTGG - Intronic
909601818 1:77468893-77468915 AGGAGGCACAGAGCTAGGCTAGG + Intronic
910112056 1:83693258-83693280 AAGCCACACAGAGCCCGGCTGGG + Intergenic
912429094 1:109619837-109619859 AAGGGCCGCAGAGCCTGGCGCGG + Intronic
915943743 1:160135371-160135393 GAGAGGCGAGGAGCCAGGCTTGG + Intronic
916791874 1:168132303-168132325 GAGAGCCACAGCGCCCGGCTTGG - Intronic
918448951 1:184640970-184640992 AAGAGGAGCAGAGGCTGGCAGGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922561052 1:226569846-226569868 AAGAGGGGTAGAGCCTGGCAGGG + Intronic
1064208981 10:13347830-13347852 GAGAGGGGCAGCGCCGGGCTTGG - Intronic
1066549782 10:36543990-36544012 AAGAGTGGCAGAGCCGGGCGTGG + Intergenic
1069024730 10:63527387-63527409 AAGAGCCACTGTGCCCGGCTTGG - Intronic
1069855794 10:71440321-71440343 AAGAAGCTCAGAGCCTGGCAGGG + Intronic
1070033748 10:72701955-72701977 ATGAGCCACAGCGCCCGGCTGGG - Intronic
1070544021 10:77438704-77438726 AAAAGGGGCAGAGCCAGGATTGG + Intronic
1072163331 10:92788287-92788309 AAGAGCCCCAGAGCCAGGCATGG - Intergenic
1073030243 10:100519889-100519911 AAGCGGCGCGGACCCCGGCAGGG + Intronic
1073439833 10:103545869-103545891 GAGTGGCCCAGAGCCTGGCTGGG + Intronic
1075067709 10:119300795-119300817 AAGAAGTGCAGAACCTGGCTGGG + Intronic
1076754468 10:132562075-132562097 AAGGGCCGAAGAGCCAGGCTTGG + Intronic
1076882004 10:133244212-133244234 AAGAGACGCTGGGGCCGGCTAGG - Intergenic
1078219374 11:9338773-9338795 ATGAGCCACAGAGCCCAGCTAGG + Intergenic
1078852637 11:15178509-15178531 AAGAGGGGCTGAGCCAGGCTTGG + Intronic
1079243330 11:18736143-18736165 AATAGGTGCAGACCCCGGCATGG + Intronic
1083227756 11:61295308-61295330 GAGAGGCGCGGAGCCCGGGGCGG + Exonic
1083331780 11:61901975-61901997 GAGAGGCGCAGAGACTGACTCGG - Intronic
1084408486 11:68992474-68992496 AGGAGGCGCAGAACCAGGCGTGG + Intergenic
1084713937 11:70861902-70861924 AAGAGGAGCAGAGCCCAATTTGG + Intronic
1085558315 11:77446214-77446236 AAGAAGCTCAGACCCAGGCTGGG + Intronic
1087049857 11:93875070-93875092 ATGAGCCACAGCGCCCGGCTTGG + Intergenic
1089195934 11:116694037-116694059 GAGAGGCGGGGAGCCCTGCTGGG - Intergenic
1091565571 12:1645727-1645749 AAGAGGCCCAGAGGGTGGCTGGG - Intronic
1093894607 12:24562374-24562396 AAGTGGCACAGAGGCGGGCTGGG + Intergenic
1096572828 12:52533607-52533629 GAGAGGTGCAGAGCCCGTCAAGG - Intergenic
1096580735 12:52583078-52583100 GAGGGGCGCAGAGCCTGTCTAGG + Intergenic
1096626639 12:52899874-52899896 AGGAGCTGCAGAGCCTGGCTGGG - Exonic
1097378146 12:58862144-58862166 GAGAGGCCCAGAGCTCAGCTTGG + Intergenic
1101911980 12:108866910-108866932 ATGAGGCTCAGAGCAAGGCTAGG + Intronic
1102942200 12:116953299-116953321 CAGAGGCTCAGGGCCAGGCTGGG + Intronic
1104775068 12:131386034-131386056 AAGAGGCACAGACCTCAGCTGGG + Intergenic
1105923335 13:24984906-24984928 CTGAGGCTCAGAGGCCGGCTGGG + Intergenic
1105943531 13:25171172-25171194 CAGAGCCGCAGGGCCCGGCGGGG - Exonic
1113819715 13:113204446-113204468 GAGAGGCGGAGACCCCTGCTGGG + Intronic
1117253576 14:53956766-53956788 AAGGAGCGCGGAGCCCGGCCCGG - Exonic
1118030381 14:61812733-61812755 AACCGGCGCCGAGCCCGGCCGGG - Intergenic
1119554370 14:75542059-75542081 GGGAGGCGCAGAGCAGGGCTTGG - Intronic
1120001436 14:79307530-79307552 AAGAGACCCTGAGCCCAGCTAGG - Intronic
1121407123 14:93725886-93725908 CAGAGCTGCAGAGCCAGGCTGGG - Intronic
1122819585 14:104334836-104334858 AAGTGGGGCAGAGGCCGGCCTGG - Intergenic
1123050273 14:105538053-105538075 AAGGGACCCAGAGCCGGGCTCGG - Intergenic
1124983193 15:34583019-34583041 AAGGGGCGAAGATCCGGGCTCGG + Intronic
1125730924 15:41892451-41892473 AAGAGGAGCAGGGCCTGTCTTGG - Intronic
1129669720 15:77600664-77600686 AGGAGGGGCAGAGCTAGGCTAGG - Intergenic
1132785076 16:1652404-1652426 GAGAGGCGCTGAGCCAGGCCAGG - Intronic
1133233244 16:4376235-4376257 AGGAGGCTCAGGGCCCGGCTGGG - Intronic
1133771093 16:8867650-8867672 AAGAGGCGCAGAGCCCGGCTGGG - Intronic
1134442931 16:14310077-14310099 GAGAGGCGCAGAGCTCGGGCTGG - Intergenic
1137594713 16:49716028-49716050 AAGAGGCACAGGGCCAGGCAGGG + Intronic
1139492091 16:67291609-67291631 AGGAGGCGCAGGGCTCGGCCTGG + Intronic
1141646397 16:85370240-85370262 GGGAGGGGCAGAGCCTGGCTGGG - Intergenic
1141665614 16:85463745-85463767 AAGAGTCACAGAGCCCGCCGAGG + Intergenic
1141671610 16:85494990-85495012 CACAGGGGCAGAGCCCTGCTGGG + Intergenic
1142207856 16:88792494-88792516 GTGAGGCGCAGAGCCCTGCGTGG + Intergenic
1142622915 17:1176236-1176258 AAGAGGCACAGGGCCAGGTTGGG + Intronic
1143323886 17:6086017-6086039 AAGAGGCTCAGAGCCTGGCTGGG + Intronic
1143571788 17:7763804-7763826 AAGAGCCCCAGATCCCAGCTAGG - Intronic
1144131761 17:12253345-12253367 AAGTTGCGCAGGCCCCGGCTGGG + Intergenic
1148564424 17:48624970-48624992 AAGAGGCGGACAGCCCGGGCTGG + Intronic
1148772900 17:50077149-50077171 AAGACGCGGGGAGCCCTGCTTGG - Intronic
1150280612 17:63927958-63927980 AAGTGGAGCACAGCCTGGCTTGG + Intergenic
1151560130 17:74865607-74865629 CAGAGGCACTGAGCCCAGCTTGG + Intronic
1152312226 17:79558407-79558429 TCCAGGCGCAGAGACCGGCTGGG + Intergenic
1152407741 17:80107322-80107344 AAGAGGCGCACCGCCTGGCTGGG - Intergenic
1159037638 18:63293029-63293051 ATGAAGCTCAGAGCCCAGCTTGG - Intronic
1162853086 19:13446737-13446759 ATGAGCCACAGAGCCCAGCTGGG + Intronic
1162918472 19:13886672-13886694 AAGAGGCAATGAGCCAGGCTGGG + Intronic
1163768676 19:19177842-19177864 GAGAAGAGCAGAGCCCGGCTTGG - Intronic
1164415199 19:28041281-28041303 AAGAGTAGCAGAGTCAGGCTTGG + Intergenic
1164626072 19:29728896-29728918 AAGATGCTGAGAGCCTGGCTGGG - Intergenic
1164750553 19:30651302-30651324 AAGAGGCACAGTGCCCAACTGGG - Intronic
1164783031 19:30908942-30908964 TGGAGGCACAGAGCCCCGCTTGG - Intergenic
1166105554 19:40596531-40596553 ATCAGGGGCAGAGCCTGGCTGGG + Intronic
1166854731 19:45777881-45777903 AAAAGGAGCAGAGCGAGGCTTGG + Intronic
1167003503 19:46759893-46759915 AAGGGGCCCAGAGTCTGGCTGGG + Intronic
925342581 2:3147539-3147561 AAGAGGCCCAGACCCCGGCTGGG + Intergenic
926714186 2:15910991-15911013 AGGAGGCCTAGAGCCCAGCTGGG + Intergenic
931180918 2:59899882-59899904 AAGAGAGGCAGACCCAGGCTTGG - Intergenic
931515884 2:63050579-63050601 AAGCGGCGCAGAGCTAGGCGAGG - Intronic
931711088 2:64989456-64989478 GAGAGGCGCAGAGTGCGGGTTGG - Exonic
932697398 2:73968391-73968413 AAGAGGCAGAGAGCCTGGGTGGG - Intergenic
934513208 2:94964775-94964797 AAGAGGCGCAGAGAACAGCCAGG + Intergenic
941747964 2:169107269-169107291 AAGAGGAGCAGAGCTCAGATAGG + Intergenic
941929928 2:170929297-170929319 GAGCAGCGCGGAGCCCGGCTCGG + Exonic
946365266 2:219245267-219245289 AAGGGGAGCAAAGCCGGGCTCGG - Exonic
947917109 2:233839756-233839778 AAGAGGCACATCGCCAGGCTAGG + Intronic
1169082286 20:2804978-2805000 AGGAGGGGCAGGGCCGGGCTTGG - Intergenic
1172085403 20:32378225-32378247 AAGAGGTCAAGAGCCAGGCTGGG - Intronic
1173161164 20:40653479-40653501 AGGAGGCACTGAGCCCAGCTGGG - Intergenic
1173898004 20:46565604-46565626 ATGAGTGGCAGAGCCCGGCCTGG + Intronic
1174538293 20:51269664-51269686 ATGAGGCACAGAGCTGGGCTGGG + Intergenic
1175936354 20:62515926-62515948 GAGAGGCGCAGAGCCAAGCATGG + Intergenic
1176931336 21:14814449-14814471 AACATGCACAGAGCCAGGCTAGG - Intergenic
1179226413 21:39457647-39457669 AAGACCCACAGTGCCCGGCTGGG - Intronic
1179727302 21:43347651-43347673 AACAGGGCCAGAGCCGGGCTGGG - Intergenic
1180624296 22:17183750-17183772 AAGAGTCCCAGAGCCCGGTGCGG - Intronic
1181365686 22:22375552-22375574 AAGAGCTGCAGAGACCAGCTGGG + Intergenic
1182299123 22:29328289-29328311 CAGAGGGGCAGAGCTAGGCTGGG - Exonic
1183349933 22:37329479-37329501 AAGAGGGACAGAGCCAGGCAGGG + Intergenic
1184493341 22:44823266-44823288 AGGAGGCACAGAACCCAGCTGGG + Intronic
1184663590 22:45976473-45976495 GAGAGGCGCCGAGCCCAGCGCGG - Intronic
1184673660 22:46028601-46028623 AAGAGGCTCAGAGCCTTTCTTGG + Intergenic
952819438 3:37473324-37473346 AAGAGGAGAAGAGCCAGACTTGG - Intronic
953385264 3:42502594-42502616 AAGAGGCGCAGCTCAGGGCTGGG - Intronic
953913630 3:46904969-46904991 AAGGGCTGCAGAGCCAGGCTGGG + Intergenic
954774613 3:53005592-53005614 AGGAGCCACAGAGCCCAGCTGGG + Intronic
964612435 3:158628387-158628409 AAGGTGCTCAGAGCACGGCTTGG + Intergenic
966914884 3:184579153-184579175 CAGAGGCAGAGAGCCCAGCTGGG + Intronic
966928292 3:184659708-184659730 AAGAAGCTCAGGGCCTGGCTGGG + Intronic
968600836 4:1508597-1508619 AGGGTGGGCAGAGCCCGGCTGGG - Intergenic
968673028 4:1862596-1862618 AAAATCCGAAGAGCCCGGCTGGG + Intergenic
968968709 4:3782380-3782402 AGGTGGCGCAGAGGCAGGCTGGG - Intergenic
969457338 4:7307525-7307547 AAGGGCAGCAGAGCCAGGCTGGG + Intronic
969639371 4:8387848-8387870 AGGACACGCAGAGCTCGGCTGGG + Intronic
973289854 4:48460162-48460184 AAGGGGCACAGAACCCTGCTGGG - Intergenic
980913743 4:139015924-139015946 CCGAGGAGCGGAGCCCGGCTGGG - Exonic
981033838 4:140151566-140151588 CGGCGGCGCAGAGCCCGGCAGGG - Intronic
992888628 5:81183765-81183787 AAGAGGTGGAGAGACCAGCTTGG - Intronic
997197425 5:131989244-131989266 ATGAGGGGCAGAGCCAGGGTGGG + Intronic
999755518 5:154661520-154661542 ATGAGGCACCGCGCCCGGCTAGG - Intergenic
1004998602 6:21217903-21217925 AAGAGGCACTGTGCCCAGCTGGG + Intronic
1006694778 6:35921349-35921371 AAAAGGCGCAGAGAGCGGCAGGG + Intergenic
1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG + Intergenic
1008027274 6:46652820-46652842 AGGAGGGGCAGGGCCGGGCTAGG + Intronic
1008069732 6:47087225-47087247 AAGAGGCACATAGCCAGGCATGG - Intergenic
1014495732 6:122119705-122119727 AAGAGGTGCAGGGCTAGGCTTGG - Intergenic
1018049652 6:159997627-159997649 GAGAGGGGCAGAGAGCGGCTAGG - Intronic
1019077713 6:169403207-169403229 AAGACTCGCAGAGCCAGGCATGG - Intergenic
1019331236 7:461850-461872 AAGCGGGGCAGAGCCGGGGTCGG + Intergenic
1022533561 7:31081835-31081857 CAGAGGAGCAGAGCCCAGCCTGG - Intronic
1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG + Exonic
1023836665 7:44072674-44072696 CAGAAGCACAGAGCCTGGCTCGG + Exonic
1024747091 7:52420590-52420612 GAGAGACTCAGAGCCCGGTTGGG - Intergenic
1027336065 7:77151928-77151950 GAGAGGTGCAGAGGCTGGCTGGG - Intronic
1029779720 7:102719171-102719193 GAGAGGTGCAGAGGCTGGCTGGG + Intergenic
1032292015 7:130597194-130597216 AGAAGGAGCAGAGCCCTGCTAGG + Intronic
1032529728 7:132610223-132610245 AGGAGGAGCAGGGCCAGGCTGGG - Intronic
1033247163 7:139727293-139727315 AAGAGTGGCAGAGCCTGGCTGGG + Intronic
1035397289 7:158543368-158543390 TAGAGGGGCACAGCCCTGCTGGG - Intronic
1039031077 8:33310427-33310449 ATGAGTCACTGAGCCCGGCTGGG - Intergenic
1041725098 8:61010885-61010907 AAGCAGCGCAGCGCCTGGCTGGG + Intergenic
1047311768 8:123698072-123698094 AAGAGCCGCAAAGTCAGGCTGGG + Intronic
1047956797 8:129982828-129982850 AAGAGGTGGTGAGCCCAGCTGGG - Intronic
1049290338 8:141798327-141798349 AAGAGGGGAAGAGCGGGGCTTGG + Intergenic
1049552644 8:143267574-143267596 AAGGGCCGCACGGCCCGGCTGGG - Intronic
1049748748 8:144273820-144273842 AGGAGGCGCTGGGCCTGGCTGGG - Intronic
1050730235 9:8701350-8701372 GTGAGCCGCTGAGCCCGGCTGGG - Intronic
1052507412 9:29373770-29373792 AGGAAGGGCAGAGCCCAGCTAGG + Intergenic
1052955451 9:34250222-34250244 AAAAGGGGCAGAGCTAGGCTTGG + Intronic
1059386153 9:113966007-113966029 ACGAGTCGCAGAGCCAGCCTGGG - Intronic
1060811065 9:126611783-126611805 CCGAGGCGCGGAGCGCGGCTCGG - Intergenic
1061038774 9:128127897-128127919 CAGAGCCGCAGAGGCCCGCTCGG + Exonic
1061206520 9:129167078-129167100 AAGAGGGGCAGATCCTGGATTGG + Intergenic
1061869788 9:133514606-133514628 CAGGGGCTCAGAGCCGGGCTGGG + Exonic
1062022444 9:134326006-134326028 AGGAGGCGGAGAGCCGGGCCGGG - Intronic
1185557334 X:1031750-1031772 AGGAGGAGCAGAGCCCAGCTCGG + Intergenic
1187709463 X:22039249-22039271 AAGAGCCACTGTGCCCGGCTGGG + Intronic
1188483044 X:30653637-30653659 AAGAGGCGCTGAGCCGGGGCGGG + Intronic
1188487546 X:30699644-30699666 AGGAGGCACAGTGCCCGGCTGGG + Intronic
1194977942 X:100411456-100411478 AAAAGCCTCAGAGCCCGGGTGGG - Intergenic
1200062210 X:153488691-153488713 AAGAGGCGCAGGGACCGGGGCGG - Intronic
1201145137 Y:11060417-11060439 ATGAGCCACAGTGCCCGGCTGGG + Intergenic