ID: 1133772801

View in Genome Browser
Species Human (GRCh38)
Location 16:8877356-8877378
Sequence GATCCACTTGCTGTTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133772801_1133772803 13 Left 1133772801 16:8877356-8877378 CCTGTCAGAACAGCAAGTGGATC No data
Right 1133772803 16:8877392-8877414 TTTTTTTTTTTTTTCCAAGACGG 0: 90
1: 683
2: 6599
3: 103260
4: 102909

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133772801 Original CRISPR GATCCACTTGCTGTTCTGAC AGG (reversed) Intergenic
No off target data available for this crispr