ID: 1133775575

View in Genome Browser
Species Human (GRCh38)
Location 16:8892470-8892492
Sequence GGCAGGCGCTATCGTGGGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133775575_1133775585 5 Left 1133775575 16:8892470-8892492 CCACGCCCACGATAGCGCCTGCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1133775585 16:8892498-8892520 GAAGGGCCTCGTGACACATCAGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133775575 Original CRISPR GGCAGGCGCTATCGTGGGCG TGG (reversed) Exonic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904314238 1:29650005-29650027 GGCTGGTACTATCTTGGGCGTGG + Intergenic
906415833 1:45621044-45621066 GGCAGGGGCTAGCATGGGCTAGG - Exonic
917892892 1:179456486-179456508 GGCAGTGGCTATGGTGGGAGTGG - Intronic
918364728 1:183795609-183795631 GGCAGGGGCTAACCTGGGCAAGG + Intronic
922169568 1:223143289-223143311 GGCGGGCCCTTCCGTGGGCGGGG - Intergenic
922196725 1:223365031-223365053 GGGAGGCGCTCCCGGGGGCGGGG + Intergenic
1076670349 10:132117586-132117608 GGCAGGGGCGGGCGTGGGCGAGG + Intronic
1076683500 10:132186845-132186867 GGCGGGCCCTATCGGGGGCGGGG + Intergenic
1077308543 11:1878462-1878484 GGCAGGCGGATTCGGGGGCGCGG + Intronic
1084180542 11:67443522-67443544 GGCAGGGGCTCGCGGGGGCGGGG + Intronic
1084271847 11:68033274-68033296 GGCAGGGGCTCACCTGGGCGGGG - Exonic
1085409189 11:76281587-76281609 TGCAGGGGCCATGGTGGGCGAGG + Intergenic
1085457386 11:76672712-76672734 GGCTGGGGCTATGGTGGGCTGGG + Intergenic
1090381639 11:126331637-126331659 GCCAGGCGCTGTGCTGGGCGAGG + Intronic
1096801464 12:54113211-54113233 GGCAGGCTCTCTCCTGGGCCTGG + Intergenic
1104929964 12:132333455-132333477 GGCAGGCTCTTGCGTGGGTGGGG + Intergenic
1112562960 13:100529906-100529928 GGGAGGCGCCATGGTGGCCGTGG - Intronic
1114054313 14:18953286-18953308 GGCAGACGCTGTGGGGGGCGGGG - Intergenic
1114189466 14:20429743-20429765 GGCAGGCCCTAAGGTGGGCAGGG - Intronic
1128605386 15:69033071-69033093 GGCCGGCGCGGGCGTGGGCGGGG - Exonic
1132519724 16:381666-381688 CGCGGGCGCCATCGGGGGCGTGG - Intronic
1132548044 16:542422-542444 GGCAGGAGCTGTCGAGGGAGTGG - Intronic
1133021046 16:2967118-2967140 GGCGGGCGCCATCGAAGGCGCGG - Exonic
1133283192 16:4678611-4678633 GGCAGGGGCTGTGGTGGGCAGGG + Intronic
1133775575 16:8892470-8892492 GGCAGGCGCTATCGTGGGCGTGG - Exonic
1139472239 16:67184445-67184467 GGCCGGCGCGAGCGCGGGCGCGG + Exonic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141503431 16:84460211-84460233 AGCAGGCGGTATGGTGGGAGTGG - Intronic
1142177480 16:88651694-88651716 GGCAGGGGCTGGCGTGGGGGTGG + Intergenic
1142671184 17:1488094-1488116 GGCAGGAGCCAGCGGGGGCGCGG + Intronic
1147366473 17:39962809-39962831 GGCAGGTGCCAGCGTGGGTGGGG - Intergenic
1151747142 17:76017799-76017821 GGCAGGTGCTGGCCTGGGCGCGG - Exonic
1154326559 18:13395549-13395571 GGCAGGAGCTGGCGTGGGAGCGG + Intronic
1154326599 18:13395657-13395679 GGCAGGAGCTGGCGTGGGGGCGG + Intronic
1155215055 18:23635874-23635896 GGCAGGCTCTGTGGTGGGGGAGG + Intronic
1166311907 19:41967617-41967639 GGCAGGCGCTGGTGTGGGCAGGG + Intronic
1167360480 19:49027833-49027855 GGCAGGCGCTACAGTGAGCCAGG - Intronic
1167363169 19:49040967-49040989 GGCAGGCGCTACAGTGCGCCGGG + Intergenic
927443384 2:23136032-23136054 GGCAGGCGCTGGCCTGGGTGGGG + Intergenic
937203681 2:120222790-120222812 CGCAGGCGCCTCCGTGGGCGCGG - Exonic
943355321 2:186848831-186848853 GGAAGGCGCTTTCGGGGGTGAGG + Intronic
1175708881 20:61203297-61203319 GGCGGGAGCTGTCCTGGGCGTGG + Intergenic
1176221047 20:63969569-63969591 GGCAGGGCCGATCGCGGGCGCGG + Intronic
1181672228 22:24431008-24431030 GGCAGGGGCTATCGTGAGTCAGG + Intronic
952334300 3:32391803-32391825 GGCGGGCGCTGGCGAGGGCGGGG - Exonic
953680095 3:45032603-45032625 GGCAGGCACTATGCTGGGCAGGG - Intronic
974242899 4:59274428-59274450 GGCAGGGGCTATGATGGACGGGG - Intergenic
980767257 4:137322322-137322344 GGCAGGCTCTTTTGTGGGGGGGG + Intergenic
981504241 4:145482228-145482250 GGGAGGCGCCATCATGGGGGGGG - Intronic
985537464 5:473228-473250 CGCAGGCGCTGGCGTGGGCGAGG + Intergenic
985672332 5:1213238-1213260 GGCAGGGGCTGTGGGGGGCGGGG - Intronic
986721527 5:10564140-10564162 GGCAGGCGCTCTCTCGAGCGCGG - Intergenic
1002419372 5:179137709-179137731 GGCAGGCCCTAGGGTGGGCAGGG - Intronic
1007924511 6:45640686-45640708 GGCAGGCGCCATCGTCAGTGGGG - Intronic
1027514550 7:79125530-79125552 GGCAGTGGCTATGGTGGGAGTGG + Intronic
1029217948 7:98965374-98965396 GGCAGGGGCTGTGGTGGGCATGG + Intronic
1029596941 7:101542919-101542941 GGCATGCGCTTTCGTGGGCCTGG - Intronic
1030713563 7:112782978-112783000 GCCAGGCACTATAGTGGGTGCGG - Intronic
1035833953 8:2728111-2728133 GGCAGCCGCGCTCGTGGGGGAGG - Intergenic
1039936581 8:42051599-42051621 GGCCGGCGGGATCGGGGGCGCGG + Intronic
1049557285 8:143289417-143289439 GGCAGGCGCAGTCGGGGTCGTGG - Intergenic
1049558486 8:143295828-143295850 GGCAGGCGCTCCCGAGGGAGAGG + Exonic
1057895928 9:98908648-98908670 GGCTGGCGCTCTCGAGGGTGGGG - Intergenic
1058612907 9:106794207-106794229 GGCAGGGGGGATCGGGGGCGGGG + Intergenic
1060114605 9:120930091-120930113 GCCAGGCGTGGTCGTGGGCGTGG - Intergenic
1061010606 9:127952298-127952320 GGGAGGCGCTATACAGGGCGTGG - Intronic
1062606553 9:137351153-137351175 GGCAGGAACCATCGTGGGAGGGG + Intronic