ID: 1133776999

View in Genome Browser
Species Human (GRCh38)
Location 16:8904400-8904422
Sequence TGGTGACCCGGAGTCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133776991_1133776999 13 Left 1133776991 16:8904364-8904386 CCTGCACTTGTGTATAGAGATGG 0: 1
1: 0
2: 2
3: 9
4: 102
Right 1133776999 16:8904400-8904422 TGGTGACCCGGAGTCCCAGAAGG 0: 1
1: 0
2: 3
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133776999 Original CRISPR TGGTGACCCGGAGTCCCAGA AGG Intronic
900347090 1:2215098-2215120 GGGTGACCGGGAGTCCCACTAGG + Intergenic
900648215 1:3718481-3718503 TGCTGACCCTGAGGCCCAGGCGG + Intronic
901222446 1:7590852-7590874 TGGTGATCCTGATTCTCAGACGG - Intronic
901728668 1:11262332-11262354 TGGGGACCCCACGTCCCAGACGG + Intronic
902744125 1:18461806-18461828 TGCTGCCTCGGTGTCCCAGAAGG - Intergenic
903821025 1:26102697-26102719 TGGTGACCCCGAGGCCCACAAGG + Intergenic
904804756 1:33122937-33122959 TGGTGAAACGGAATCCCAGGAGG - Intergenic
906676195 1:47695129-47695151 TGATGTCCCCGAGACCCAGAGGG - Intergenic
911550233 1:99269509-99269531 TTGTGAGCCTGAGCCCCAGAGGG - Intronic
911794394 1:102058293-102058315 TGGTGACACGGGTTCACAGAAGG - Intergenic
922700669 1:227758243-227758265 TGGGGACGCTGAGTCCCTGAAGG + Intronic
923784870 1:237056916-237056938 TGGAGGCCCAGAGTCCGAGATGG - Intronic
1062929868 10:1345581-1345603 TGGTGACCTGGATTCCCATCTGG + Intronic
1063560545 10:7122270-7122292 TGGTGGCCTGCAGTCACAGAGGG + Intergenic
1064256246 10:13744810-13744832 TGGTGAATCTGAGGCCCAGAGGG + Intronic
1068945389 10:62724140-62724162 AGGCAACCCGAAGTCCCAGAGGG + Intergenic
1069687931 10:70331025-70331047 TGGGGACCCTGAGGCTCAGAAGG - Intronic
1071138853 10:82483297-82483319 TGGTGACTGGGTCTCCCAGATGG + Intronic
1073084214 10:100878075-100878097 TGGTCAACCAGACTCCCAGATGG + Intergenic
1073348210 10:102800414-102800436 TGGGGACAGGGAGACCCAGAGGG + Intronic
1075398554 10:122144812-122144834 TGTTGGTCCTGAGTCCCAGAGGG + Intronic
1076223416 10:128753980-128754002 AGGTGAACCAGAGTCCCAGCGGG - Intergenic
1077054558 11:584619-584641 TGGAGACCTGGAGCCCCTGAGGG + Intronic
1077068108 11:653820-653842 AGGAGCCCCGGATTCCCAGAGGG + Intronic
1077342243 11:2031323-2031345 TGTTGACCCTGAGGCCCAGTAGG + Intergenic
1077467098 11:2738601-2738623 TGGTGACTCGGGGGCCCAGGAGG - Intronic
1080461231 11:32456629-32456651 TGGAGATCCAGAGTCCCAAATGG - Intergenic
1081540970 11:44034200-44034222 TGAAGACCCACAGTCCCAGATGG - Intergenic
1083341269 11:61959882-61959904 TGGTGACCAGGTGTCCCTGTTGG + Exonic
1087204019 11:95375110-95375132 TGGGGATCCTGACTCCCAGAGGG + Intergenic
1087281924 11:96220408-96220430 TGCTGACTCTGAGTCCCAGGAGG - Intronic
1088874361 11:113921491-113921513 TGGGCACCTGTAGTCCCAGATGG + Intronic
1088977114 11:114825615-114825637 TGGTGGCCCTGAGTCCCATGGGG - Intergenic
1202825229 11_KI270721v1_random:86512-86534 TGTTGACCCTGAGGCCCAGTAGG + Intergenic
1094474496 12:30830967-30830989 TGAAGACCCTGAGTCCCACAGGG - Intergenic
1096742137 12:53701752-53701774 TAGACACCCAGAGTCCCAGAGGG + Intergenic
1105036197 12:132923801-132923823 TGTTTAACTGGAGTCCCAGAAGG - Exonic
1108313655 13:49218673-49218695 TGGTCACCCGTAGTCCCTGAGGG - Intergenic
1118654633 14:67933478-67933500 TGGTGATCTGGAGACCCACAAGG - Intronic
1122415141 14:101545880-101545902 TGGTGCTCTGGAGTCACAGAGGG - Intergenic
1122422581 14:101586915-101586937 TTGTGTCCAGGAGTCCCTGAAGG + Intergenic
1122714440 14:103686065-103686087 GGGAGACCCGGAGTCCGAGCGGG - Intergenic
1123931258 15:25172776-25172798 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123932556 15:25178891-25178913 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123933371 15:25182538-25182560 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123933796 15:25184459-25184481 TGGAGACCTGGAGTCCTTGAAGG + Intergenic
1123937293 15:25200131-25200153 TGGTGTCCCAGAGTCCCTGTTGG - Intergenic
1123938024 15:25203380-25203402 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123942502 15:25223400-25223422 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123947431 15:25245630-25245652 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1125436515 15:39651026-39651048 TGGTCAGATGGAGTCCCAGAGGG + Intronic
1131260124 15:90883811-90883833 TGGGGAGCCTGAGTCCCAAATGG + Intronic
1131992620 15:98105605-98105627 TGGAGACCCTGAGCCCCAGAAGG + Intergenic
1132098310 15:99004869-99004891 TGGAGACCCTGAGCCCCAGAAGG - Intronic
1133021191 16:2967645-2967667 TGGGGAGCTGGAGCCCCAGAAGG + Intronic
1133776999 16:8904400-8904422 TGGTGACCCGGAGTCCCAGAAGG + Intronic
1134001137 16:10783912-10783934 TGGTTGCCAGGAGTTCCAGAGGG + Intronic
1138451167 16:57093973-57093995 TGGTGACCCAGAGGGCCACAGGG - Intronic
1139582907 16:67883874-67883896 TGGTGGCACCGAGGCCCAGAGGG - Intronic
1140413179 16:74753794-74753816 TGGTGCTCCGGAGTCACAAAGGG + Intronic
1141054326 16:80803010-80803032 TGGTTTCACGGAGGCCCAGAAGG + Intronic
1141193352 16:81840928-81840950 TGGGGATGGGGAGTCCCAGAGGG + Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1142513632 17:413371-413393 TGCTGACCCGGAGGCAGAGAAGG + Exonic
1142856826 17:2735379-2735401 TGGAGAACCAGAGGCCCAGAGGG + Intergenic
1149582766 17:57762697-57762719 TGGAGACCAGGAGCTCCAGATGG + Intergenic
1150292916 17:63992077-63992099 TGGTGACCAGCAGTCCCAGATGG - Intergenic
1152101538 17:78304592-78304614 TGTGGACCCGGAATTCCAGAGGG - Intergenic
1155176757 18:23307815-23307837 TGGGGACTCAGAGTCCCAGGAGG - Intronic
1161220527 19:3116082-3116104 TGGAGCCCCGGAGGCCCAGCAGG - Intronic
1164722992 19:30445587-30445609 CAGTGACCAGGAGTCCCAGTCGG + Exonic
925159432 2:1673644-1673666 TGGAGACCCGAAGTACCTGAGGG + Exonic
925318520 2:2943032-2943054 TGGTGACTCAGAGTCCCAAGAGG - Intergenic
925489652 2:4377381-4377403 AGGAGACCCTGGGTCCCAGAGGG + Intergenic
925884074 2:8379466-8379488 TGGTGACCTGAAGACCCAAACGG + Intergenic
926478106 2:13353254-13353276 AGGTTCCCCAGAGTCCCAGATGG + Intergenic
926907220 2:17816842-17816864 TGGTGGCCCCAAGGCCCAGAAGG + Exonic
927562410 2:24083411-24083433 TGGAGAAACTGAGTCCCAGACGG + Intronic
927809247 2:26172846-26172868 TGGGGACCCGGGGTCCCAGAAGG + Intergenic
929770210 2:44885550-44885572 TGGGGACCCTGACTCCCAGTTGG - Intergenic
930018172 2:46984963-46984985 TGGTGATTCAGGGTCCCAGAGGG - Intronic
930094480 2:47556519-47556541 TGGTGACCCTGAGTACCAGCTGG - Intronic
932765152 2:74464767-74464789 GGATGACCCGGAGACCCGGAGGG - Intronic
933597080 2:84292799-84292821 TGGGGAACCAGAGGCCCAGAGGG - Intergenic
940599631 2:155842415-155842437 TGGTGACCCGCACTCCTACAGGG - Intergenic
941677788 2:168362372-168362394 TGGTGTTACGGAGTCCCAAAAGG - Intergenic
941857135 2:170242643-170242665 TGGGGACCCAAAGTCCCTGAAGG - Intronic
942848689 2:180456871-180456893 TGGAGACTTGGAGTCCCAGTAGG - Intergenic
948468340 2:238162751-238162773 TGGGGACCGGGAGGCCCAGGGGG - Exonic
1168841580 20:913325-913347 TGGGGACCAGGAGTGTCAGAGGG + Intronic
1170830560 20:19836014-19836036 TGGTAGCCCGGAATACCAGATGG - Intergenic
1170950646 20:20932876-20932898 TGGTGAAAGGGATTCCCAGATGG + Intergenic
1171086912 20:22246077-22246099 TGGAGAGCCGGAGTCCGAGCGGG - Intergenic
1173604874 20:44324754-44324776 TGCTGACCCTGTGCCCCAGATGG - Intergenic
1175189238 20:57199914-57199936 TGGTGTCCCGGAGTCAGAGGGGG + Intronic
1177884342 21:26731175-26731197 TGGTGACCAGAGGTCCCAGCTGG + Intergenic
1178167419 21:29995785-29995807 TGGTAACCTGGAGTCACACATGG - Intergenic
1181480865 22:23198334-23198356 TGGTGGGCTGGAGTCCCAGGGGG + Intronic
1182080421 22:27524826-27524848 TGGGGACACTGAGGCCCAGAAGG + Intergenic
1182328025 22:29529116-29529138 TGGTGACCTGGTGTCCCTGGGGG + Intronic
1183335086 22:37241765-37241787 TGGGGAGACGGAGGCCCAGAGGG - Intronic
1183703517 22:39463114-39463136 TGATGACCCGGAGGCCAAGGTGG - Intronic
1183948605 22:41340409-41340431 TGGTGACCCAGGGTCCCGGGAGG - Intronic
1183980097 22:41534278-41534300 TGGGCACCCGGAGTCCCCCATGG + Intronic
1184695559 22:46137107-46137129 TGGGGACATGGAGGCCCAGAGGG - Intergenic
950108874 3:10405760-10405782 TGGTGAACCTGCCTCCCAGATGG + Intronic
951748243 3:26003660-26003682 TGGTGATGGGGACTCCCAGAAGG + Intergenic
953063977 3:39452390-39452412 TAGTTAACCGGAATCCCAGAGGG - Intergenic
960280048 3:115771311-115771333 TGATGACCATGAGTTCCAGAGGG + Intergenic
961825959 3:129599206-129599228 TGGAGACCGGGAGTCACAGGCGG + Intronic
968283217 3:197492700-197492722 TGGAGAAACTGAGTCCCAGAGGG - Intergenic
968622562 4:1610468-1610490 TGGTGACCGGGGATCCCAGCAGG + Intergenic
968973736 4:3810451-3810473 AGGTGACTGGGAGTCCCAGAAGG + Intergenic
972247009 4:37255782-37255804 ATATGACCCTGAGTCCCAGAGGG + Intronic
972312360 4:37892768-37892790 TGTTGACCTGGTGTCCCATAAGG + Intronic
973607473 4:52601927-52601949 TGAAGAGCCGGAGTTCCAGAGGG + Exonic
984375630 4:178925229-178925251 TTGTGTCTCAGAGTCCCAGAAGG + Intergenic
990665509 5:58067854-58067876 CGGTGACCAGGAGTCACAGATGG + Intergenic
1001635533 5:173207508-173207530 TGGTGACCAGGAGTGGGAGATGG + Intergenic
1001780351 5:174363417-174363439 TGATGACCCTGAGTTCCAGAGGG + Intergenic
1002200690 5:177526147-177526169 GGGTGACCCTGCGTCCCAGCAGG + Intronic
1002574219 5:180162341-180162363 TGGAGAAACTGAGTCCCAGAGGG + Intronic
1002911569 6:1494930-1494952 TGGAAACCCGGAAGCCCAGATGG - Intergenic
1004641555 6:17521045-17521067 TGGCCACCCAGAGCCCCAGAAGG - Intronic
1010212049 6:73369756-73369778 TGGTGCCGCTGAGTCCCAGCGGG - Exonic
1015366205 6:132400979-132401001 TGCTCTCCCGGAGCCCCAGAAGG - Intronic
1017147490 6:151247849-151247871 TGGTGTCCCGGTGTCCCAGATGG - Intronic
1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG + Intronic
1020257362 7:6509556-6509578 TGGTCACCAGGGGTCCCAGCTGG + Intronic
1027541353 7:79470641-79470663 TGGTGCCAGGGAGTCCGAGAAGG - Intergenic
1036910923 8:12755869-12755891 TGGTGACCCGGAGTCCCGCGCGG - Intronic
1037781568 8:21872766-21872788 TGTTGACCCTGATACCCAGAGGG - Intergenic
1045968325 8:108051773-108051795 TCTTGAGCTGGAGTCCCAGATGG - Intronic
1048379192 8:133849326-133849348 TGGTGGCCTGCAGTCCCAAAGGG - Intergenic
1049206034 8:141364010-141364032 TGAGGAACCGGAGGCCCAGAGGG + Intronic
1049386447 8:142345280-142345302 TGGGGGCCTGGTGTCCCAGAAGG + Intronic
1049414962 8:142490937-142490959 TGGTGACACGGAGGCCCATGCGG - Intronic
1049614356 8:143569614-143569636 GGCTGACCCCGAGTCCCAGCAGG - Exonic
1053168091 9:35858860-35858882 TTGTCATCCTGAGTCCCAGAGGG + Intergenic
1053447382 9:38163595-38163617 TGGGGAAACTGAGTCCCAGAGGG + Intergenic
1055729295 9:79264238-79264260 AGGTGGCCAGGAGTCCCAGCTGG + Intergenic
1061059934 9:128245195-128245217 GGGTGGCCGGGAGCCCCAGAGGG - Intronic
1061364846 9:130167168-130167190 TGGTGTCCAGGAGCCCCTGAGGG - Intergenic
1061620093 9:131806389-131806411 TGGGAACACGGAGACCCAGAGGG - Intergenic
1062276482 9:135733732-135733754 TGCTGAGCCGGAGACCCAGATGG + Intronic
1185891908 X:3829237-3829259 TGGTGACGTGGAGTCCCACCAGG + Intronic
1185897013 X:3867651-3867673 TGGTGACGTGGAGTCCCACCAGG + Intergenic
1185902131 X:3906077-3906099 TGGTGACGTGGAGTCCCACCAGG + Intergenic
1187397159 X:18928714-18928736 TGATGACCCTGAGGCACAGAAGG + Intronic
1188973355 X:36643887-36643909 TGGTTACCAGGAGTCAAAGAGGG - Intergenic
1189114549 X:38329335-38329357 TGGTGAGCAGAAGCCCCAGAAGG + Intronic
1192602752 X:72481932-72481954 TGATAACCTGGAGTCCCAGGTGG + Intronic
1197535868 X:127688961-127688983 TGTAGACCCTGATTCCCAGATGG - Intergenic
1198029015 X:132737099-132737121 TGGAGACCCTGAGGCTCAGAAGG + Intronic
1200073760 X:153541331-153541353 TGGTGCCCCGGAAGCACAGAAGG - Intronic