ID: 1133777176

View in Genome Browser
Species Human (GRCh38)
Location 16:8905935-8905957
Sequence GGAGCTCGGTGCTGGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133777169_1133777176 -4 Left 1133777169 16:8905916-8905938 CCACCAAATCCCCTTGGCAGGAG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1133777176 16:8905935-8905957 GGAGCTCGGTGCTGGCCCTGTGG 0: 1
1: 0
2: 0
3: 26
4: 313
1133777166_1133777176 0 Left 1133777166 16:8905912-8905934 CCCTCCACCAAATCCCCTTGGCA 0: 1
1: 0
2: 1
3: 24
4: 218
Right 1133777176 16:8905935-8905957 GGAGCTCGGTGCTGGCCCTGTGG 0: 1
1: 0
2: 0
3: 26
4: 313
1133777170_1133777176 -7 Left 1133777170 16:8905919-8905941 CCAAATCCCCTTGGCAGGAGCTC 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1133777176 16:8905935-8905957 GGAGCTCGGTGCTGGCCCTGTGG 0: 1
1: 0
2: 0
3: 26
4: 313
1133777167_1133777176 -1 Left 1133777167 16:8905913-8905935 CCTCCACCAAATCCCCTTGGCAG 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1133777176 16:8905935-8905957 GGAGCTCGGTGCTGGCCCTGTGG 0: 1
1: 0
2: 0
3: 26
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133777176 Original CRISPR GGAGCTCGGTGCTGGCCCTG TGG Intronic