ID: 1133778277

View in Genome Browser
Species Human (GRCh38)
Location 16:8915437-8915459
Sequence CGCGGCAAAATGGTGGTATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133778277_1133778285 9 Left 1133778277 16:8915437-8915459 CCACATACCACCATTTTGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1133778285 16:8915469-8915491 GGGTATGGTGCCCTCTACACAGG 0: 2
1: 0
2: 0
3: 4
4: 73
1133778277_1133778283 -6 Left 1133778277 16:8915437-8915459 CCACATACCACCATTTTGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1133778283 16:8915454-8915476 GCCGCGGAATAATTTGGGTATGG 0: 1
1: 0
2: 0
3: 3
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133778277 Original CRISPR CGCGGCAAAATGGTGGTATG TGG (reversed) Exonic
904803977 1:33118129-33118151 TGCTGGAAAATGGGGGTATGGGG + Intronic
909814550 1:79975716-79975738 CTGGGCACAATGGTGGTCTGGGG - Intergenic
910448857 1:87327825-87327847 CTCGGAAAAATGGGAGTATGAGG + Intergenic
918238188 1:182600003-182600025 TGGGGCAAAAAGGTGGTATGGGG - Exonic
1071519624 10:86321333-86321355 CGGGCCAAAATGGTGGCCTGGGG + Intronic
1074100099 10:110348163-110348185 CCCGGCAAAGTGGTGGAGTGGGG + Intergenic
1083751501 11:64763436-64763458 AGCGGCAAAGTGGCGCTATGTGG - Intergenic
1089351777 11:117825383-117825405 CCAGGCCAAATGGTGGTAGGAGG - Intronic
1090396226 11:126420561-126420583 AGCTGCAAATTGCTGGTATGTGG + Intronic
1093269329 12:17039578-17039600 CCCAGAAAAGTGGTGGTATGTGG + Intergenic
1104584618 12:130038088-130038110 TGCGGGAGAATGGTGGTATGCGG - Intergenic
1132695619 16:1200575-1200597 GGCGGCAAGATGGTGGGACGGGG + Intronic
1133778277 16:8915437-8915459 CGCGGCAAAATGGTGGTATGTGG - Exonic
1147582755 17:41636384-41636406 GGGGGCTAAATGGTGGTATTGGG - Intergenic
1166359752 19:42248214-42248236 CTGGGCAAAGTGGTGGTAGGGGG - Exonic
1167719874 19:51172045-51172067 CCCTGCAAAAAGGTGGGATGAGG - Intergenic
930223763 2:48771256-48771278 TGCGAGAAAATGGTGGTGTGGGG + Intronic
935624838 2:105163602-105163624 AGTGGCAAAATGGTGGGAGGTGG - Intergenic
937027852 2:118714073-118714095 GGCTGCAAAGTGGTGGTCTGAGG + Intergenic
945824941 2:214710214-214710236 GGCAGGAGAATGGTGGTATGGGG + Intergenic
948665794 2:239534109-239534131 CACGGCTAAATGGAGGAATGAGG - Intergenic
949752179 3:7366415-7366437 TGCAGCAAAATGGTGGACTGAGG - Intronic
962310559 3:134323978-134324000 CTGAGCAAGATGGTGGTATGAGG + Intergenic
973213555 4:47643245-47643267 CTTGGCAAAATGCTGGCATGGGG + Exonic
978523201 4:109637743-109637765 CTCGGGAAAATGGTGGGAGGGGG + Intronic
984851723 4:184159798-184159820 CATGGCAAAAGGGTGGGATGGGG - Intronic
1004375357 6:15086366-15086388 GGCGGCAAGATGGAGGCATGGGG - Intergenic
1013643743 6:112114457-112114479 CGCTGCAAAATTGTGTTAAGGGG - Intronic
1013993551 6:116280791-116280813 CCTCACAAAATGGTGGTATGTGG - Intronic
1020374933 7:7474285-7474307 CGGGGCAAAAGGGTGGGAAGAGG + Intronic
1023460024 7:40386337-40386359 CCCGTCAAGATGGTGGGATGAGG - Intronic
1025120471 7:56297453-56297475 TGGGGCAAAAAGGTGGGATGTGG - Intergenic
1031352921 7:120757639-120757661 AGCAACAAAATGGTGGTATAGGG + Intergenic
1058654780 9:107210241-107210263 CACGGGAAAAGGGTGGGATGGGG + Intergenic
1058819018 9:108712107-108712129 GGGGGCAAATTGCTGGTATGAGG - Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1191926045 X:66311207-66311229 CTCAGCAGAATGGTGGTATTGGG - Intergenic