ID: 1133778722

View in Genome Browser
Species Human (GRCh38)
Location 16:8919755-8919777
Sequence CATTGTGTACAGAGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133778722_1133778733 24 Left 1133778722 16:8919755-8919777 CCCATCTCCCTCTGTACACAATG 0: 1
1: 0
2: 1
3: 5
4: 167
Right 1133778733 16:8919802-8919824 ACCAAGCGGGACCAGTGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 103
1133778722_1133778729 11 Left 1133778722 16:8919755-8919777 CCCATCTCCCTCTGTACACAATG 0: 1
1: 0
2: 1
3: 5
4: 167
Right 1133778729 16:8919789-8919811 ACACACGACCGTCACCAAGCGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1133778722_1133778731 22 Left 1133778722 16:8919755-8919777 CCCATCTCCCTCTGTACACAATG 0: 1
1: 0
2: 1
3: 5
4: 167
Right 1133778731 16:8919800-8919822 TCACCAAGCGGGACCAGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
1133778722_1133778735 25 Left 1133778722 16:8919755-8919777 CCCATCTCCCTCTGTACACAATG 0: 1
1: 0
2: 1
3: 5
4: 167
Right 1133778735 16:8919803-8919825 CCAAGCGGGACCAGTGCTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 136
1133778722_1133778732 23 Left 1133778722 16:8919755-8919777 CCCATCTCCCTCTGTACACAATG 0: 1
1: 0
2: 1
3: 5
4: 167
Right 1133778732 16:8919801-8919823 CACCAAGCGGGACCAGTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 74
1133778722_1133778728 10 Left 1133778722 16:8919755-8919777 CCCATCTCCCTCTGTACACAATG 0: 1
1: 0
2: 1
3: 5
4: 167
Right 1133778728 16:8919788-8919810 AACACACGACCGTCACCAAGCGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133778722 Original CRISPR CATTGTGTACAGAGGGAGAT GGG (reversed) Intronic
902547698 1:17200194-17200216 CATTTTGTAAATAGGGAGACTGG + Intergenic
903098357 1:21002784-21002806 CATTCTGTCCAGAGGGATAAGGG + Exonic
906808557 1:48803365-48803387 CACTGTAGGCAGAGGGAGATTGG - Intronic
907826470 1:58021890-58021912 CATTGTGTTCAGAAGCAGAAGGG + Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
910191994 1:84604327-84604349 CATTGTGTACAGAGAGGGGATGG - Intergenic
913048306 1:115092046-115092068 CAGTGTGTACACAGCGAGAGTGG + Intergenic
916768087 1:167881319-167881341 CATTGTGAATAAAGGGTGATGGG + Intronic
920348825 1:205324059-205324081 AATCCTGTACAGAGGGAGAAGGG + Intergenic
924194357 1:241590091-241590113 CATTGTATAGAGAGGGATAAAGG - Exonic
1067429077 10:46231062-46231084 TATTGTGTACTGGTGGAGATTGG - Intergenic
1067719567 10:48717484-48717506 GAATGTGTACACAGGGAGCTTGG - Intronic
1069262787 10:66419858-66419880 TTTTGTGTACAGTGAGAGATAGG - Intronic
1069640576 10:69952870-69952892 CATTATTTACAGGGGGAGAGGGG + Exonic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1072664925 10:97385791-97385813 CCTTGTCTACAGAGTGAGGTTGG - Intronic
1074247516 10:111709842-111709864 TCTTGTGTACAGAGGGGGATTGG - Intergenic
1076568767 10:131417435-131417457 CATTGTCCTCAGAGGGGGATCGG + Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1078302664 11:10148682-10148704 TGTTTTGTACAGAGGGAGACAGG - Intronic
1079729765 11:23925370-23925392 CTTTGAGAACAGAGGGAGTTTGG - Intergenic
1080771309 11:35344702-35344724 CATTGTCTGAAGAGGGAGGTTGG - Intronic
1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG + Intronic
1082775308 11:57240206-57240228 CATTCTGTACAGTGGGGGCTGGG + Intergenic
1083668200 11:64286415-64286437 CAGGGTGCAGAGAGGGAGATGGG - Intronic
1087076567 11:94131396-94131418 TGTTGTGTGCTGAGGGAGATGGG + Intronic
1087179692 11:95129389-95129411 CATGGTGTACACAGGGAAAGTGG - Exonic
1087308272 11:96508842-96508864 CATTCTTTACAGAGAGAGAAGGG + Intergenic
1092736310 12:11586148-11586170 CCTTGTTTTTAGAGGGAGATGGG + Intergenic
1096813846 12:54189039-54189061 CATTGTTTAGGGAAGGAGATTGG + Intergenic
1097323303 12:58248454-58248476 CACTGTGTACTGAGGTAGCTGGG + Intergenic
1100167928 12:91939379-91939401 AATTGTGGACATAGGGAGAGTGG - Intergenic
1102605762 12:114066146-114066168 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1106078936 13:26484643-26484665 CAATGAGTCCAGAGGCAGATCGG - Intergenic
1108506794 13:51119455-51119477 CATGGCGTACAGAGTGAGAGGGG + Intergenic
1108992825 13:56684543-56684565 CATTGGGTACAGAGTCATATTGG - Intergenic
1112883127 13:104133971-104133993 CAGAGTGTAAAGAAGGAGATGGG + Intergenic
1115469150 14:33749875-33749897 CACTGTGTGGAGAGGAAGATTGG - Intronic
1116148673 14:41108481-41108503 TATTGTGTACTGATGGGGATTGG - Intergenic
1117306628 14:54483266-54483288 CATTGTGTACATAGTGACTTTGG - Intronic
1120996358 14:90421276-90421298 CAGTGTTTGAAGAGGGAGATTGG - Intergenic
1121051832 14:90824274-90824296 CATTCTGGGCAGGGGGAGATAGG - Intergenic
1123691186 15:22839299-22839321 AATTGTATAGAGAGGGAAATAGG - Intronic
1125750689 15:42025630-42025652 GCTTGGGTACAGAGGGAGGTAGG - Intronic
1126872295 15:53002567-53002589 CATTCTAGACAGAGGGAGCTGGG - Intergenic
1131498652 15:92937991-92938013 GATTGTGTAGAGAAGGAGGTAGG + Intronic
1132379586 15:101357551-101357573 TATTGTGTACACAGGGAGGCAGG - Intronic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1134280522 16:12812884-12812906 GATTGTCTAGAGAGAGAGATTGG - Intergenic
1138841478 16:60513615-60513637 CTTTGTGTACAGTGTGATATAGG + Intergenic
1140455659 16:75104042-75104064 TATTGGGGACAGAGGGATATGGG - Intronic
1141255905 16:82402098-82402120 CATTTTGCCCTGAGGGAGATGGG + Intergenic
1148064211 17:44856890-44856912 CATTGTGTTCAAAGGCAGAAGGG + Intronic
1152340455 17:79721328-79721350 GATGGTGGACAGAGGGAGAAAGG + Intergenic
1157362786 18:47034536-47034558 CCTTGTGTGCCCAGGGAGATTGG - Exonic
1158557909 18:58490455-58490477 GACTTTGTTCAGAGGGAGATGGG - Intronic
1160969700 19:1762145-1762167 CACTGCGTCCAGGGGGAGATGGG - Intronic
925362555 2:3289593-3289615 CATGGTGCACATAGGGAGACAGG - Intronic
925651516 2:6094469-6094491 CATTGTGTTTAGAGGCAAATAGG + Intergenic
927463790 2:23322021-23322043 CAGAGTGTGCAGAGGGAGATGGG + Intergenic
929734449 2:44532041-44532063 CATTCTGTACAGAGGTCTATAGG - Intronic
929903939 2:46029759-46029781 CATCCTGTACAGAGGGAGTCAGG + Intronic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
936744390 2:115557164-115557186 CAGTATGTACAGAGAGAGAGAGG - Intronic
936844181 2:116810523-116810545 CAATGTGTACAAAAGGAAATTGG - Intergenic
937077821 2:119119765-119119787 CAATAAGTACAAAGGGAGATTGG - Intergenic
937212464 2:120283924-120283946 CATTGAGTACAGAGGTATGTAGG + Intronic
939834380 2:147110535-147110557 CATTGCCTACAGAGTGAGAAAGG + Intergenic
941226721 2:162858658-162858680 CTTTGTTCACAGAGGGAGACAGG + Intergenic
941360915 2:164550236-164550258 CATTCTGTTCAGTGGGAGAATGG - Intronic
944206907 2:197166172-197166194 CATTGTGTAAAGAAGGTGTTAGG - Intronic
945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG + Intergenic
946618998 2:221540828-221540850 CATAGGCAACAGAGGGAGATGGG + Intronic
947112624 2:226735327-226735349 TATTGTAAACAGAAGGAGATGGG - Exonic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947829074 2:233126013-233126035 CCTGGTGACCAGAGGGAGATGGG + Intronic
948285754 2:236783799-236783821 CAGAGTGAACAGCGGGAGATGGG - Intergenic
1169504034 20:6189229-6189251 CATTTTCTACATATGGAGATAGG - Intergenic
1170341135 20:15328280-15328302 CACTGTGGCCAGAGGGAGAGAGG + Intronic
1170588950 20:17756583-17756605 CAGTGGGGACAGAGGCAGATTGG + Intergenic
1172470727 20:35192672-35192694 GCTTGGGTACAGAGGGAGGTGGG - Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1179180549 21:39041152-39041174 GATTGAGTACAGAGTCAGATAGG + Intergenic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1182547771 22:31085613-31085635 CATTGTCTACCGAGGGGGAAGGG - Intronic
1183500221 22:38174442-38174464 GAGTGGGAACAGAGGGAGATTGG + Intronic
1184464947 22:44663478-44663500 CAATGGGAACAGAGAGAGATTGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949525574 3:4900172-4900194 GAGTGTATACAGAGGGAGAGAGG - Intergenic
950194638 3:11000507-11000529 GATTGTGGCCAGAGTGAGATCGG + Intronic
950668901 3:14513553-14513575 CACTGGGCACAGAGGGGGATGGG + Intronic
952014466 3:28940521-28940543 CAGTGTTTACAGAGGAAGAAGGG - Intergenic
954317105 3:49807152-49807174 CATTGAGGACACAGGAAGATGGG + Intronic
954594787 3:51815154-51815176 TTTTGTGCACAGAAGGAGATGGG + Intergenic
956854864 3:73266033-73266055 CATTCTGGACATAGGGACATAGG + Intergenic
957136835 3:76299123-76299145 CATTGTATTCGGAGAGAGATGGG + Intronic
957249138 3:77750451-77750473 CATTATGGAAAGAGGCAGATTGG + Intergenic
957580310 3:82064146-82064168 GCATGTGTATAGAGGGAGATAGG + Intergenic
958639155 3:96781915-96781937 CATTTTATATAGTGGGAGATAGG + Intergenic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
962769306 3:138597513-138597535 CATTGTGCACTCAGGGAGCTCGG - Intergenic
966088958 3:176107309-176107331 CTGCGTGTACACAGGGAGATGGG + Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975941236 4:79649228-79649250 CAATGTGTTGAGAGGAAGATTGG - Intergenic
978974705 4:114855444-114855466 TTTTGTGTACGGAGAGAGATAGG + Intronic
980826003 4:138073951-138073973 TATTTTGGAAAGAGGGAGATGGG + Intergenic
984600498 4:181721142-181721164 CATTATGTACAAAGGCAGAGAGG + Intergenic
985298400 4:188459849-188459871 TAATGTGTACACAGGGGGATGGG - Intergenic
985657694 5:1140554-1140576 CATTCTGTAAACAGGGAGATGGG + Intergenic
986286776 5:6365123-6365145 CAGGGGGTACTGAGGGAGATGGG - Intergenic
987745943 5:21972032-21972054 CATATTGTACAAAGGGAGAATGG - Intronic
995208943 5:109515127-109515149 AAATGTCTTCAGAGGGAGATTGG - Intergenic
995426892 5:112034588-112034610 CATTGAGCAAAGAGGGAGAGAGG - Intergenic
996683046 5:126249185-126249207 CATTGTCTACTGAAGCAGATAGG + Intergenic
999078089 5:148816409-148816431 CAGTGTTTACATGGGGAGATAGG + Intergenic
999185898 5:149708516-149708538 AATTGGGTACAGAAGGGGATGGG + Intergenic
1000122673 5:158212196-158212218 CATGGTGGGCAGAGAGAGATGGG + Intergenic
1000802042 5:165739915-165739937 CATTGGAAAGAGAGGGAGATTGG + Intergenic
1004264726 6:14139200-14139222 GATTGTCTGCAGAGGCAGATGGG + Intergenic
1004512448 6:16294074-16294096 CTTTGTGAAGAGAGGGACATGGG + Intronic
1005799242 6:29403222-29403244 GAATGTGTAGAGGGGGAGATGGG + Intronic
1007200994 6:40109132-40109154 CATATTCTTCAGAGGGAGATTGG - Intergenic
1007707938 6:43802650-43802672 TATTGTGTGCAGAGGGTGAGAGG - Intergenic
1008726396 6:54426403-54426425 CATTGTGTAAAGATTCAGATGGG - Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009570795 6:65381413-65381435 CAGTGTGAACACATGGAGATAGG + Intronic
1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG + Intergenic
1014491011 6:122061781-122061803 CCTTGAGTACAGAGAGAGCTGGG + Intergenic
1015519676 6:134117778-134117800 CATTGAGAAGCGAGGGAGATGGG - Intergenic
1015666346 6:135634049-135634071 CAATGGGTACAGAGGCAGGTAGG - Intergenic
1015945168 6:138492287-138492309 CATTGTACACACAGGGAGAGAGG - Intronic
1017406884 6:154129111-154129133 AATTGTGTACTCAGGGAGCTTGG - Intronic
1017550242 6:155498171-155498193 CAGTGGTTACAGAGGGAGTTTGG + Intergenic
1018875551 6:167819310-167819332 CACTGTGGACACAGGGACATAGG - Intergenic
1023798798 7:43815189-43815211 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1024535412 7:50426929-50426951 CTGTGTGTACAGGGTGAGATGGG - Intergenic
1024616813 7:51122389-51122411 CATTGTGTTCAGAGGCACAAAGG - Intronic
1025049588 7:55723128-55723150 GAATGTGTGCAGAGGGAGGTGGG - Intergenic
1026227230 7:68453054-68453076 CATTGTGTACAGAGGGTGAGGGG + Intergenic
1028672236 7:93415317-93415339 TATTGTATACAGTGTGAGATAGG + Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1030440662 7:109584371-109584393 TATTATGTAGACAGGGAGATAGG - Intergenic
1030644853 7:112048611-112048633 CATTAAGTACAGAGGAAGAAAGG + Intronic
1031163983 7:118204892-118204914 TATTGTGTAAAGGTGGAGATGGG - Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1032353425 7:131186985-131187007 CATTGTGTGCAGAGTTAGAGAGG + Intronic
1032847697 7:135765927-135765949 CATATTGGACAGAGGGAGAAAGG + Intergenic
1037479858 8:19294536-19294558 CATTGTGTAGATAAGGACATTGG + Intergenic
1037862594 8:22416359-22416381 CACTGTGAAGACAGGGAGATGGG - Intronic
1038987844 8:32832847-32832869 CATTGTGTCCTGAGGAAGATGGG + Intergenic
1043050413 8:75378318-75378340 CATTGTGTACAGAAGAACAATGG + Intergenic
1055950960 9:81729244-81729266 CATTGTATATAGAGAGAGCTTGG + Intergenic
1056815390 9:89797181-89797203 TATTGTTTTCAGAGGGAGACAGG + Intergenic
1056815402 9:89797272-89797294 TATTGTTTTCAGAGGGAGACAGG + Intergenic
1056825737 9:89875170-89875192 CACTGTGTCCAGAGGGACATGGG + Intergenic
1057624420 9:96664977-96664999 CATTGTGTACTGGTGGAGACTGG + Intergenic
1058142491 9:101372101-101372123 CATTGGGTACACACGGACATTGG + Intronic
1060003202 9:119977147-119977169 CAGTGTGTAAAGAGTGAGAGAGG - Intergenic
1060143033 9:121226848-121226870 CATTCTCTAAAGAGGGAGAAGGG + Intronic
1186643018 X:11476590-11476612 CATTGTGTACAGTGAAAGACAGG + Intronic
1187076422 X:15939574-15939596 CATTGAGAACACATGGAGATAGG - Intergenic
1188212358 X:27441362-27441384 CAGTTTGTACAGAGAGAGAGAGG + Intergenic
1190852000 X:54253824-54253846 AATTTTGTACAGAGGTAAATTGG - Intronic
1192303995 X:69938768-69938790 CTTTGTTTACAGTGAGAGATAGG + Intronic
1193418861 X:81258837-81258859 CCTTGTGTACAGGGACAGATTGG + Intronic
1194271089 X:91816708-91816730 CAATGTGGACTGAGGGACATTGG + Intronic
1196905388 X:120427080-120427102 CATTGTGCTGAGAGGTAGATTGG + Intergenic
1198233438 X:134715001-134715023 GATTGTGGAGAGAGGGGGATGGG - Intronic
1199637451 X:149826864-149826886 CCTTAGGTACAGAGGGAAATGGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200588330 Y:5038148-5038170 CAATGTGGACTGAGGGACATTGG + Intronic
1201726050 Y:17153144-17153166 TTTTGTATACAGTGGGAGATAGG - Intergenic
1202047577 Y:20749971-20749993 CATTTTGTACAGGGGAAGAGGGG + Intergenic