ID: 1133779138

View in Genome Browser
Species Human (GRCh38)
Location 16:8923561-8923583
Sequence TGTATGTTATCTCAGTCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133779138 Original CRISPR TGTATGTTATCTCAGTCTTC GGG (reversed) Intronic
900434351 1:2621310-2621332 AGTCTGTTCTCTCAGTCTTAAGG - Intronic
901611220 1:10499966-10499988 TGTATTTGATCTCAGTCCTGGGG + Intronic
901980014 1:13026522-13026544 TGCATGTTATCCCAGCCTTTTGG + Intronic
906088713 1:43158824-43158846 TGCATGTAAACTCACTCTTCTGG - Intergenic
908269911 1:62412409-62412431 TGTGTGTGATCTGATTCTTCCGG + Intergenic
910505619 1:87947202-87947224 TGAATTTTATCTCAGTCTTTGGG + Intergenic
910505670 1:87947593-87947615 TGAATTTTATCTCAGTCTTTGGG - Intergenic
912350729 1:109010249-109010271 TGTATGTTTTCTTAATGTTCAGG - Intronic
915380904 1:155439435-155439457 TGTCTGTAATCCCAGTATTCTGG + Intronic
916488301 1:165278867-165278889 TGTACCTTCTCTCAGCCTTCTGG - Intronic
917570757 1:176263015-176263037 TGTTGGTTACCTCAGTCTTGGGG + Intergenic
920282042 1:204851277-204851299 TAGATGTTATATCAGTCTTGGGG - Intronic
921546284 1:216478551-216478573 TGAAGGTTATTTCAGACTTCCGG + Intergenic
924850296 1:247822380-247822402 TTTCTGTTATCTCTGTCTTCAGG + Intergenic
1063501422 10:6558503-6558525 TATCTTTTATCTCAGTTTTCTGG - Intronic
1067477632 10:46577430-46577452 TGCATGTTATCTCACAGTTCGGG - Intergenic
1068199891 10:53769634-53769656 AGTATGTTATTTCAATCTTGTGG + Intergenic
1079591802 11:22191979-22192001 TCTATGTAGTCTCAATCTTCTGG + Intergenic
1080240730 11:30124373-30124395 TGTATGTTAATACAATCTTCTGG + Intergenic
1080502678 11:32885560-32885582 TGTGTGTGACCTCATTCTTCTGG + Intergenic
1082723110 11:56703417-56703439 TATATGCCAACTCAGTCTTCTGG + Intergenic
1084073422 11:66753240-66753262 TTTATGCTATCTCTGTCTTGCGG + Intronic
1084409768 11:69000018-69000040 TGTCTGTAATCCCAGTATTCTGG - Intergenic
1085658323 11:78338076-78338098 AGTATGTTACCTGACTCTTCAGG + Intronic
1085914189 11:80865115-80865137 TGAATGGTATTTCTGTCTTCAGG - Intergenic
1086040967 11:82478533-82478555 TGAATGGTATTTCTGTCTTCAGG - Intergenic
1088028207 11:105213102-105213124 TGTATGTTATCTTAGTCATTTGG + Intergenic
1088352192 11:108902348-108902370 GGTATGTTAGCTCAGGATTCTGG - Intronic
1088365258 11:109033563-109033585 TGAATGGTATTTCTGTCTTCAGG + Intergenic
1090218950 11:124998352-124998374 TTTTTGTTTTCTCAGTCTTCAGG + Intronic
1090499709 11:127249469-127249491 TCTCTGTTATCTTCGTCTTCTGG + Intergenic
1095237854 12:39820326-39820348 TTTGTGTTATCACAGTTTTCAGG + Intronic
1096119045 12:49074821-49074843 TGTCTGTAATCTCAGTGTTTTGG - Intergenic
1098321704 12:69251207-69251229 TCCATGTAATCTCGGTCTTCTGG - Exonic
1098737337 12:74122356-74122378 TGTATGTTATGTTAATATTCAGG - Intergenic
1098789623 12:74805293-74805315 TGAATGTTATTTCTGTCTTTAGG - Intergenic
1101745810 12:107540632-107540654 TCTATGTTATCTAAGTCCTAAGG - Intronic
1104185609 12:126427631-126427653 TGTATATAATGTCAGGCTTCTGG - Intergenic
1106188271 13:27427468-27427490 TTTATGTTAGCTCAGCCTCCTGG - Intronic
1107526235 13:41234437-41234459 TGTCTGTAATCTCAGCATTCAGG - Intronic
1109618565 13:64870788-64870810 ATTATCTTATCTCAATCTTCTGG + Intergenic
1109647435 13:65276527-65276549 TGTATGTTATTTCCTTTTTCTGG + Intergenic
1110412290 13:75217765-75217787 TGAATGTTATCCGAGTCTGCAGG - Intergenic
1110633645 13:77739114-77739136 TGAATTTTATATCAATCTTCCGG - Intronic
1110894452 13:80731799-80731821 TGTATGGTATTTCTGTCTTTAGG + Intergenic
1111722902 13:91969639-91969661 TGTATGTTATTTAAGTATTTTGG - Intronic
1111790095 13:92844251-92844273 TGTAAGTTTTCTCAGTCATAGGG + Intronic
1114079767 14:19193740-19193762 TGCCTGTAATCTCAGTGTTCTGG - Intergenic
1114720086 14:24872398-24872420 TGTATGTTATCACTGACTTCAGG - Intronic
1114793485 14:25685456-25685478 TGTATGTTAGCTCATTCAACAGG - Intergenic
1117271053 14:54143842-54143864 TCTATTTTATTTCAGTCATCAGG + Intergenic
1123631544 15:22263678-22263700 TGTCTGTGAACTAAGTCTTCTGG + Intergenic
1124179581 15:27460078-27460100 TTTAGGTAAACTCAGTCTTCAGG - Intronic
1124916489 15:33979682-33979704 TGTCTTTTTTCTCACTCTTCAGG - Intronic
1125281670 15:38048076-38048098 CGTATTTGATCTCAGTCTTCAGG - Intergenic
1127522439 15:59756019-59756041 TGTATGATATGTCATACTTCAGG + Intergenic
1129027528 15:72591492-72591514 TGTGTGTTTGCTCAGTCCTCAGG - Exonic
1129554078 15:76486797-76486819 TGAATGTTATGTCTGTCTTTGGG - Intronic
1130124747 15:81083872-81083894 TGTATGATATGTAAGCCTTCTGG - Intronic
1131800534 15:96064572-96064594 AGCATGTGACCTCAGTCTTCAGG - Intergenic
1131972904 15:97910284-97910306 TTTATGTTTTCTCCCTCTTCTGG - Intergenic
1132729336 16:1353412-1353434 TGTATTTTATCTAATTCTACAGG - Intronic
1133779138 16:8923561-8923583 TGTATGTTATCTCAGTCTTCGGG - Intronic
1134027511 16:10965677-10965699 TGTACGTAATCTCAGTCTCTCGG - Intronic
1134790924 16:16988541-16988563 TGTATCTTTTCTTAATCTTCTGG + Intergenic
1135249224 16:20886552-20886574 TGGATGTTATCTCTTTCTCCTGG - Intronic
1138031164 16:53560447-53560469 TGTCTGTTGGCTCAGTCTTGGGG + Intergenic
1140878452 16:79175341-79175363 TGTAAGGTATCTAAGACTTCTGG + Intronic
1141971456 16:87486768-87486790 TGTCTGTGAACTAAGTCTTCTGG - Intronic
1142612399 17:1116467-1116489 TGTCTGGGATCTCCGTCTTCTGG - Intronic
1144591277 17:16525885-16525907 TGTCTGTAATCTCAGTACTCTGG - Intergenic
1147853600 17:43461075-43461097 TGTCTGTAATCCCAGTATTCTGG - Intergenic
1148826487 17:50397735-50397757 TGGATGTCAACCCAGTCTTCTGG - Intergenic
1150162844 17:62913852-62913874 TATATGTTATCGCAGGCTTTGGG - Intergenic
1150843040 17:68627183-68627205 TGTATATTCTTTCAGTCTACAGG + Intergenic
1150864997 17:68840273-68840295 TGCATGTTATCCCATCCTTCTGG + Intergenic
1152490456 17:80628875-80628897 TGTTTGTTTTCTCTCTCTTCTGG + Intronic
1156983171 18:43316912-43316934 TGTGTGTTAAATCTGTCTTCAGG + Intergenic
1157026592 18:43851839-43851861 TGTATTTTCTCACAGTCTTGGGG - Intergenic
1157142058 18:45119352-45119374 TGTGCGTTATCTCAGTCACCAGG - Intergenic
1157524430 18:48369226-48369248 TGTACATTATCACAGTCTACTGG - Intronic
1157955050 18:52087561-52087583 AATATGTTATCTCACTGTTCTGG + Intergenic
1158923163 18:62217296-62217318 TGTATGATTTTTCAGTCTTTAGG + Intronic
1160293274 18:77614928-77614950 CGTATGTTAGCTGTGTCTTCTGG - Intergenic
1162425411 19:10592396-10592418 TGTCTGTAATCTCAGTGTTTTGG - Intergenic
1163378548 19:16949177-16949199 GGTATGTTTTCTCTGTCTTGGGG + Intronic
1163477785 19:17537054-17537076 GGGATGTTATCTGAGTCGTCCGG - Intronic
1163881467 19:19926337-19926359 TGTCTGTTATCTCAGCATTTTGG - Intronic
1164951663 19:32342501-32342523 TGTATACTTTCTCAGTCTTCAGG + Intergenic
1165692044 19:37871213-37871235 AGTATGTTTTCTCAGTCTTAAGG + Intergenic
926512674 2:13802033-13802055 TTTATGTGACCTCATTCTTCAGG + Intergenic
928805752 2:35152094-35152116 AGTATGATAGCTCATTCTTCTGG + Intergenic
930386449 2:50701362-50701384 TGTATTTTATCTCACACTTTTGG + Intronic
930976769 2:57472189-57472211 TGTTTGTTCTCTCACTGTTCTGG - Intergenic
932105290 2:68936338-68936360 TCCATGTTGTCTCAGTCTCCTGG - Intergenic
932546788 2:72720083-72720105 TGCATCTTATCACAGTCTACTGG - Intronic
935007952 2:99100066-99100088 TTTATGTTATTTGAGTCTTCTGG - Intronic
935513601 2:104006351-104006373 TGTGTTTGATCTCAGTCTACAGG + Intergenic
935827819 2:106968997-106969019 TGTAGGTTATCTGTGTCTTCTGG + Intergenic
936019656 2:108985142-108985164 TGTATCTTATTTCAGTATTTGGG + Intronic
939200986 2:139033608-139033630 TCTTGGTTATTTCAGTCTTCAGG + Intergenic
939556146 2:143675995-143676017 AGTATGTTAGCTAGGTCTTCTGG + Intronic
945115221 2:206401704-206401726 TGTCTGTTCTGTCAGTCTTAAGG + Intergenic
945196065 2:207238636-207238658 TGCATGTCAGCCCAGTCTTCTGG - Intergenic
945537141 2:211031591-211031613 TGTATGTCATATCAGTTGTCTGG - Intergenic
945914821 2:215692379-215692401 TGTGTTTTAACTCATTCTTCTGG + Intergenic
946758090 2:222966348-222966370 TGTATGTAATCTCAGCATTTTGG + Intergenic
947074450 2:226327088-226327110 AGTATGTTATGACAGTCTTTTGG - Intergenic
947603717 2:231470032-231470054 AGTACGTTATCTTAGTCTGCTGG + Intronic
948580331 2:238983105-238983127 TGAATGGTATCTCTGTCTTCAGG + Intergenic
1169128123 20:3145694-3145716 TGCCTGTTATCTCAGCCTTTAGG - Intronic
1170108849 20:12783047-12783069 TGTATGTCATCACAGCCTTGGGG - Intergenic
1171014296 20:21525811-21525833 TGTCTGTTATCCCAGTTCTCTGG - Intergenic
1172302740 20:33861569-33861591 TGGAGGTCATTTCAGTCTTCAGG - Intergenic
1173183954 20:40825406-40825428 TGTCTTTTTTCTCTGTCTTCTGG - Intergenic
1173639612 20:44591558-44591580 TCTATCTTATCTCAGACTTCGGG - Intronic
1173928004 20:46795011-46795033 TGTATATTACCTCCGTCCTCAGG - Intergenic
1177182924 21:17762786-17762808 TGTCTGTAATCTCAGTATTCTGG - Intergenic
1177625528 21:23655300-23655322 TGTCTGTAATCCCAGTCTTTGGG + Intergenic
1178257321 21:31066170-31066192 AGTCTTTTATCTCAGTATTCAGG + Intergenic
1180501004 22:15928960-15928982 TGCCTGTAATCTCAGTGTTCTGG + Intergenic
1180989769 22:19928461-19928483 TGTATGTCATCTTCCTCTTCTGG - Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949107602 3:219279-219301 TGAATGGTATTTCTGTCTTCAGG - Intronic
949437966 3:4049813-4049835 TGTATGTGACCTGACTCTTCTGG - Intronic
949598056 3:5568272-5568294 TGTATGTTATTTAACTTTTCAGG + Intergenic
952189332 3:31005800-31005822 TGTCTGTAATCTCAGTACTCTGG - Intergenic
953085791 3:39665627-39665649 GGTATGTTATCTCAGTATTTTGG + Intergenic
953461332 3:43083597-43083619 TGTAACTTATCACAGTCTACTGG + Intronic
954505249 3:51064634-51064656 TTTATGATAACTCAGTCTTCAGG + Intronic
955382796 3:58453763-58453785 TGTATGTAATCTCAGCATTTTGG - Intergenic
956060035 3:65340096-65340118 TGTATGTTCTCCCACTCATCAGG + Intergenic
956369763 3:68546167-68546189 TGTATGTTCAATCAGACTTCAGG - Intergenic
957516871 3:81266390-81266412 TGTCTGTTAAATCAGTCTTTAGG - Intergenic
958442608 3:94174864-94174886 TGTCTGTAATCTCAGTATTTTGG + Intergenic
958805052 3:98800326-98800348 TGTATGTTAACTGAGGCTTGTGG - Intronic
958944177 3:100346039-100346061 TGTAAATTATCTCTGTCCTCAGG + Intronic
959043706 3:101448309-101448331 TATATTTTATCTCATTCTTTTGG - Intronic
959192973 3:103139185-103139207 TGTATGTTTACTCAGCCTTCTGG + Intergenic
961154565 3:124668006-124668028 TATGTGTTTTCTGAGTCTTCAGG - Intronic
962915997 3:139904272-139904294 TTTATGTTCTCACAGTCTCCAGG - Intergenic
964669076 3:159205481-159205503 TGTGATTGATCTCAGTCTTCAGG + Intronic
964788730 3:160429605-160429627 TGCCTGTAATCTCAGTCTTTTGG - Intronic
968379072 4:73357-73379 TGTATGCTATCTCAGACTGAAGG + Intronic
969855733 4:9997863-9997885 AATATGTTATCTCAGTCTATGGG - Intronic
970117551 4:12716077-12716099 TGAATGTTATTTCTGTCTTTAGG - Intergenic
971332593 4:25694569-25694591 TGTATCTTATCTCAGTAATCAGG + Intergenic
971656119 4:29347448-29347470 TGAATGTTATTTCTGTCTTTAGG - Intergenic
971762850 4:30790658-30790680 TGCATGTCATCTCAGACTTTGGG + Intronic
972255242 4:37348021-37348043 AGTATGTTATCACAATTTTCTGG + Intronic
973093138 4:46163582-46163604 TGAATGTTATTTCTGTCTTTAGG - Intergenic
973550664 4:52032509-52032531 TGTATTTTATCGGAGACTTCTGG - Intronic
973697225 4:53501909-53501931 TGGCTGCTATCTCTGTCTTCTGG + Intronic
974226359 4:59050353-59050375 TGCCTGTAATCTCAGTCTTTTGG - Intergenic
975564603 4:75740545-75740567 TGTCTGTAATCTCAGAGTTCTGG - Intronic
975652162 4:76604145-76604167 TGTAGAGCATCTCAGTCTTCAGG + Intronic
977772625 4:100877975-100877997 TGTATGTTTTCTAACTCTTTGGG - Intronic
979172276 4:117616350-117616372 TGTATGGTATTTCTGTCTTTAGG - Intergenic
979199461 4:117959465-117959487 AGTGTATTATCTCACTCTTCTGG - Intergenic
981660901 4:147165579-147165601 TGGACGTTTTCTCAGTCTTTTGG - Intergenic
982526000 4:156478939-156478961 TGTTTATTATCTTAGTGTTCTGG - Intergenic
983232989 4:165147989-165148011 TGAATGGTATTTCAGTCTTTAGG + Intronic
986008587 5:3689961-3689983 TGTCTGTTATTTTATTCTTCTGG + Intergenic
987446339 5:18024170-18024192 TGTGGGTTTTCTGAGTCTTCAGG + Intergenic
990394870 5:55367141-55367163 TGTGTGTTATTTCATTATTCAGG - Intronic
991149462 5:63349665-63349687 GGTTTGTTACCTCAGACTTCTGG + Intergenic
991978592 5:72208511-72208533 TGCATGCTTTCTCAGTCTTGTGG + Exonic
994585597 5:101705109-101705131 TGAATGGTATTTCTGTCTTCAGG + Intergenic
995645368 5:114305426-114305448 TGTATGTTATCTCTGTGTTGGGG + Intergenic
997155658 5:131553842-131553864 TGTATGTTGAGTAAGTCTTCTGG - Intronic
997993524 5:138566495-138566517 TGTTTGTTTTTTCAGTTTTCTGG - Intronic
999090574 5:148932273-148932295 TTTATCTTCTCTCAGTCCTCAGG - Intronic
999636507 5:153628555-153628577 TGAACATTATCTCAGTCTTCTGG + Intronic
999877583 5:155825248-155825270 TGTATGTTCTCTAAGTCTAGAGG - Intergenic
1001567423 5:172708626-172708648 TGTAAATTGTCTCAGTCCTCTGG - Intergenic
1001848388 5:174941385-174941407 TGTGTGCTGTCTCAGGCTTCTGG + Intergenic
1003702741 6:8487892-8487914 TGAATTTTATCTCAGACTTTAGG - Intergenic
1003830688 6:10007353-10007375 TGTTTGTTAGTTCAGTCTTTTGG + Intronic
1004342598 6:14820538-14820560 TGCCTGTAATCTCAGTCCTCTGG - Intergenic
1004969846 6:20897497-20897519 TGTATGTTATCTGAGGCATCTGG - Intronic
1007194724 6:40050701-40050723 TGTATATTATCTTAATTTTCTGG - Intergenic
1007297920 6:40842011-40842033 CGTAAGTTATCACAGTCTACCGG + Intergenic
1008459291 6:51749177-51749199 TGTATGGAATATCAGGCTTCTGG - Intronic
1008898911 6:56588755-56588777 TGTATGTCATCTCAGTTTCTTGG - Intronic
1012237822 6:96838081-96838103 TTTTAGTTATTTCAGTCTTCTGG - Intergenic
1012284007 6:97366492-97366514 TGTATTTTCTCCCAGCCTTCTGG - Intergenic
1012988282 6:105898336-105898358 CGTATGTTATCAGAGTCATCTGG + Intergenic
1014554948 6:122834454-122834476 AGTATGTTTTCTTATTCTTCTGG + Intergenic
1015364708 6:132384811-132384833 TGTAAGTTATCACAGTGTTTAGG - Intronic
1015627389 6:135194178-135194200 TGAATGTTATTTCAGACTTAAGG - Intronic
1016523951 6:144978122-144978144 TGAATGGTATTTCTGTCTTCAGG - Intergenic
1016566215 6:145457670-145457692 TGTATGTCATCTCATTTCTCTGG - Intergenic
1016586675 6:145696050-145696072 TGGATATGATTTCAGTCTTCTGG - Intronic
1018276259 6:162134787-162134809 TGGATGTCAGCTCATTCTTCTGG + Intronic
1019764263 7:2838201-2838223 TGTAACTTATCCCAGTCTCCTGG - Intronic
1020206214 7:6118952-6118974 TGTCTGTAATCTCAGTGTTTTGG + Intronic
1020689304 7:11335069-11335091 TGAATGTTATTTCTGTCTTGAGG - Intergenic
1024191599 7:47017120-47017142 AGTCTGTTCTATCAGTCTTCAGG + Intergenic
1028012187 7:85660125-85660147 TAAATGTAATCACAGTCTTCTGG + Intergenic
1029935104 7:104416337-104416359 TATTTGTTATCTCAATGTTCTGG - Intronic
1029937548 7:104443272-104443294 TGGGTGTTATCGCAGTATTCTGG - Intronic
1031654611 7:124338426-124338448 GATATGTTTTCTCAGTTTTCTGG + Intergenic
1032741787 7:134747257-134747279 TGCACTTTATCTCACTCTTCTGG - Intronic
1032834554 7:135661283-135661305 AGTCTGTTCTGTCAGTCTTCCGG - Intergenic
1033944295 7:146696400-146696422 TGTATGTTTTCTCTGTTTTCTGG + Intronic
1036395167 8:8363625-8363647 TGTATATTAAATCAGTCTCCAGG - Intronic
1037043937 8:14273646-14273668 TGTATGTTATCCCAGACCTTTGG - Intronic
1041845869 8:62328523-62328545 TTCCTGTTTTCTCAGTCTTCTGG + Intronic
1042421806 8:68600180-68600202 TGTAATTTATCACAGTCTACAGG + Intronic
1044309479 8:90677170-90677192 AGCCTGTTATGTCAGTCTTCAGG + Intronic
1044429623 8:92094024-92094046 TGTATGTCATTTCTGCCTTCAGG - Intronic
1044926256 8:97211261-97211283 TGTATGCTGTCTTAGTCTTTTGG + Intergenic
1045772610 8:105761089-105761111 GTCATGTTATCTCAGTCTTTGGG + Intronic
1046405005 8:113762025-113762047 TGAATGGTATTTCTGTCTTCAGG - Intergenic
1048277973 8:133081527-133081549 TGTATGTCATCAGAATCTTCGGG + Intronic
1048640778 8:136358096-136358118 TGTAAATTATTTCAGTCTTTTGG - Intergenic
1048779599 8:137986843-137986865 TGTCTGTGAGCTCAGTTTTCAGG - Intergenic
1049995860 9:1032969-1032991 TGTATGTAATCCCAGTCCTTTGG + Intergenic
1050277108 9:4011381-4011403 TCTATGTTCTCTTTGTCTTCTGG - Intronic
1050477385 9:6054234-6054256 TGTCTGTAATCCCAGTATTCCGG + Intergenic
1050654211 9:7807885-7807907 AGTATGTTCTCTCACTATTCTGG - Intronic
1051565632 9:18494759-18494781 TGTGTGTTATATCACACTTCTGG - Intronic
1052525969 9:29620826-29620848 TGAATGGTATTTCAGTCTTTAGG - Intergenic
1056423166 9:86449494-86449516 TGGATGTTTTCTCAGTCATCTGG - Intergenic
1057363369 9:94395965-94395987 TGTCTGTTATCTCTGAGTTCAGG + Intronic
1057432441 9:95005899-95005921 TGTTTATTATCTCAGTGTTAAGG + Intronic
1057617970 9:96609414-96609436 TGTATTCTTTCTCAGTCTTCAGG + Intronic
1057659967 9:96992133-96992155 TGTCTGTTATCTCTGAGTTCAGG - Intronic
1057983422 9:99685121-99685143 TGTCAGTTCTCTCAGTATTCTGG + Intergenic
1058176368 9:101739858-101739880 GGGATGTTCTCTCAGGCTTCAGG - Intergenic
1058418352 9:104811249-104811271 TGTAGTCTTTCTCAGTCTTCAGG - Intronic
1061356952 9:130113008-130113030 TGCCTGTTATCTCAGTACTCTGG - Intronic
1061541519 9:131280088-131280110 AGGATGTCATCTCAGTCTGCAGG + Intergenic
1062058449 9:134481664-134481686 CGTTTATTATCTCAGTTTTCTGG + Intergenic
1187042765 X:15614389-15614411 TGAATTTTGCCTCAGTCTTCAGG + Intergenic
1187322386 X:18251358-18251380 TGTATTTTATCCCATTCTTTGGG - Intronic
1188742446 X:33801677-33801699 TGTAAATTATTTCAGTTTTCTGG + Intergenic
1189381033 X:40502273-40502295 TGTTTCTTCTCTCTGTCTTCAGG + Intergenic
1189541622 X:41997692-41997714 TGTATATAATTTCAGTTTTCTGG + Intergenic
1192595666 X:72405499-72405521 TGAATGGTATTTCTGTCTTCAGG + Intronic
1193737605 X:85177934-85177956 TCTATCTCATCTTAGTCTTCTGG - Intergenic
1193746894 X:85293128-85293150 TGAATGGTATCTCTGTCTTTAGG - Intronic
1196604028 X:117635290-117635312 TGTAAGTTATCTTATTCTTATGG + Intergenic
1197629466 X:128841836-128841858 TATATGTACTCTCTGTCTTCTGG + Intergenic
1198045289 X:132895612-132895634 TGCATTTTGTCTCAGTCTTTAGG + Intronic
1198940767 X:141952888-141952910 TGTATACAATCTCAGGCTTCAGG - Intergenic
1199674855 X:150179971-150179993 TGAATCTTATCTCAGTATTAGGG - Intergenic
1199906226 X:152234396-152234418 TATATGTTCTCTCATTCTGCAGG + Intronic
1201262890 Y:12177547-12177569 TGGCTGCTATTTCAGTCTTCAGG - Intergenic
1202098888 Y:21284629-21284651 TGTATGTTATCACTCACTTCTGG - Intergenic
1202163245 Y:21957304-21957326 TGCCTGTTATCTCAGTATTTTGG - Intergenic
1202228111 Y:22629064-22629086 TGCCTGTTATCTCAGTATTTTGG + Intergenic
1202315046 Y:23567112-23567134 TGCCTGTTATCTCAGTATTTTGG - Intergenic
1202555755 Y:26103481-26103503 TGCCTGTTATCTCAGTATTTTGG + Intergenic