ID: 1133780612

View in Genome Browser
Species Human (GRCh38)
Location 16:8936190-8936212
Sequence ACTAGGTTGTTACTAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133780612_1133780615 3 Left 1133780612 16:8936190-8936212 CCTTCCACTAGTAACAACCTAGT 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1133780615 16:8936216-8936238 CAAAACTACAGCTGTTATTACGG 0: 1
1: 0
2: 1
3: 15
4: 180
1133780612_1133780616 16 Left 1133780612 16:8936190-8936212 CCTTCCACTAGTAACAACCTAGT 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1133780616 16:8936229-8936251 GTTATTACGGCAGATACGCATGG 0: 1
1: 0
2: 0
3: 0
4: 14
1133780612_1133780617 17 Left 1133780612 16:8936190-8936212 CCTTCCACTAGTAACAACCTAGT 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1133780617 16:8936230-8936252 TTATTACGGCAGATACGCATGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1133780612_1133780618 28 Left 1133780612 16:8936190-8936212 CCTTCCACTAGTAACAACCTAGT 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133780612 Original CRISPR ACTAGGTTGTTACTAGTGGA AGG (reversed) Intronic
910621184 1:89256823-89256845 AGTAGGTTGGGACTACTGGATGG - Intergenic
911734722 1:101324527-101324549 TCCAGGGTGTTACTGGTGGAGGG - Intergenic
912377250 1:109219964-109219986 ACTGGGTTGTTACCGGTTGAGGG + Intronic
913119506 1:115726890-115726912 ACTAGGTTGTTGCTCTTGGCAGG + Intronic
915892349 1:159783652-159783674 ACTGGGTGGTTAGTGGTGGAAGG - Intergenic
917964283 1:180168723-180168745 ACAAGGTTGTTTCTAGTGTTTGG + Intronic
922095073 1:222436413-222436435 TTTTGGTTGTTGCTAGTGGAGGG - Intergenic
924237425 1:242010987-242011009 ACTAGGTGGTAAATGGTGGAAGG - Intergenic
1068308910 10:55254053-55254075 ACTTGATTGTTACTGGTAGAAGG + Intronic
1070656103 10:78272523-78272545 GCTAAGTTCTCACTAGTGGAAGG - Intergenic
1071404719 10:85318822-85318844 ACTGGGTTGTTACTAGAGTGAGG - Intergenic
1078757234 11:14222710-14222732 ACTAGCATGTTACTGGTGGTGGG - Intronic
1079697536 11:23500970-23500992 ACCTAGTTGCTACTAGTGGAGGG - Intergenic
1091209793 11:133846288-133846310 GACAGGTTGTTACTGGTGGAGGG - Intergenic
1092619014 12:10243092-10243114 AGTAGGTTGTTACTAGAGACTGG + Intergenic
1093162717 12:15767475-15767497 AGTAGGGTGTTCCTAGAGGAGGG - Intronic
1095815240 12:46414563-46414585 AGTAAGTTGTTATTAGTGGGAGG + Intergenic
1111561435 13:89954198-89954220 ACTATGTTGCTACAAATGGAAGG + Intergenic
1116566186 14:46447035-46447057 ACCAGTTTGTTACTAGTGGAAGG - Intergenic
1116764599 14:49054572-49054594 GCTTGGTTCTTTCTAGTGGAGGG - Intergenic
1119138071 14:72238905-72238927 GCCCGGTTGTTACCAGTGGAAGG + Intronic
1120249661 14:82047839-82047861 ATTAAGTTGTTACCAGTAGAAGG - Intergenic
1124940158 15:34210292-34210314 ACTAGGTTGTTCCTAGCGCACGG - Intergenic
1124990685 15:34670417-34670439 ACTTTGATGTTACAAGTGGAAGG - Intergenic
1125918106 15:43507487-43507509 CCAAGGGTGTTACCAGTGGAGGG - Intronic
1126569329 15:50133175-50133197 TCTAGGTTGTCACAAATGGAAGG - Intronic
1133075392 16:3276503-3276525 AGTAGGTGATTATTAGTGGAAGG - Intronic
1133711748 16:8408288-8408310 ACAAGGGTGTGAATAGTGGAAGG - Intergenic
1133780612 16:8936190-8936212 ACTAGGTTGTTACTAGTGGAAGG - Intronic
1138807481 16:60107833-60107855 CCCAGTCTGTTACTAGTGGAGGG + Intergenic
1157984984 18:52427123-52427145 ACTAAGTACTTACTACTGGAAGG + Intronic
925283247 2:2699455-2699477 TCCAGGTTGTTACTAGTGAGTGG + Intergenic
927736590 2:25528624-25528646 AACAGTTTGTTACTAGTGTATGG - Intronic
941290508 2:163668032-163668054 TCTTGTTTGTTACTTGTGGAGGG - Intronic
947719545 2:232362147-232362169 ACTATATTGTCACTGGTGGAGGG - Intergenic
947996091 2:234529153-234529175 AATTGGTTGTTCCAAGTGGAGGG + Intergenic
1173152202 20:40577178-40577200 ACAAGGGTGTTTCCAGTGGATGG + Intergenic
1173511207 20:43630082-43630104 ACCAGGCTGTTACCTGTGGAAGG - Intronic
1173960054 20:47063960-47063982 ACCCTGTTGTTACTGGTGGAGGG - Intronic
1175598441 20:60253818-60253840 AGTAGGTAGATACTAGTGGAGGG + Intergenic
954357720 3:50096558-50096580 AGGAAATTGTTACTAGTGGAGGG + Intronic
957203021 3:77162233-77162255 ACCATGTTGTTATTAGTGTATGG - Intronic
958974701 3:100654194-100654216 ACTAGGTTGTCTCACGTGGAGGG + Intronic
959465009 3:106674971-106674993 AGTATGTTGTTGCTGGTGGAGGG - Intergenic
961226269 3:125250621-125250643 ATTAAGTTGTTACTAGTGTCTGG + Intronic
964819272 3:160753285-160753307 ATTAGTTTGTCACTAGAGGAAGG + Intergenic
968110278 3:196040390-196040412 ACTAGGTTGTTACAAATTTAAGG - Intronic
976288335 4:83391568-83391590 ACTAGCCTGATACTAGTAGAAGG - Intergenic
979846882 4:125524800-125524822 ACTAGCCTGTTACTGGAGGATGG + Intergenic
983838150 4:172419043-172419065 ACTTTGTTGTTACTATTGTATGG + Intronic
986122457 5:4854101-4854123 ACTTGGTTGTTTCTGGTTGAGGG + Intergenic
988250028 5:28745354-28745376 ACTAGAAGGTTAATAGTGGAAGG + Intergenic
990469595 5:56102514-56102536 GCTAGGTTGTTCCGAGTGAAAGG + Exonic
997858708 5:137396608-137396630 TCTAGGTTGTGATTAGGGGAAGG + Intronic
1000648202 5:163783725-163783747 ACTAGCTTGTTACTTGGGGAGGG + Intergenic
1008988955 6:57580310-57580332 ACTAGGTTATGAGTAGTGTAGGG + Intronic
1009177496 6:60478548-60478570 ACTAGGTTATGAGTAGTGTAGGG + Intergenic
1012124516 6:95411242-95411264 ACTAGACAGTTATTAGTGGATGG + Intergenic
1012692890 6:102337381-102337403 ACTAGATTGTTAAAACTGGAAGG - Intergenic
1022173099 7:27848343-27848365 GCTAGGTTGTTATTTGTGTATGG + Intronic
1023636246 7:42213851-42213873 ATTAGATTATTACTAGTGGGTGG - Intronic
1025038892 7:55622092-55622114 CTCAGTTTGTTACTAGTGGAAGG + Intergenic
1027696056 7:81411873-81411895 ACAATGTTGTTAACAGTGGAGGG + Intergenic
1030275187 7:107713405-107713427 ACTAGGTGGTTACTACAGAAAGG - Intronic
1030448520 7:109678641-109678663 TCTAGATTGTTACTAGTATAGGG - Intergenic
1035009690 7:155703095-155703117 ACAAGGATGTTACTAGTGGTTGG - Intronic
1037795716 8:21992854-21992876 ACCAGGATGTTACTATTGGTAGG + Intronic
1039055622 8:33534051-33534073 ACAGAGTTGTTACTGGTGGAAGG - Intergenic
1039541948 8:38380538-38380560 ACTAGATTTTTACTAGCTGAAGG - Intronic
1041567895 8:59301306-59301328 TCTAGGTTGTTATTAGTGGGAGG + Intergenic
1044137368 8:88604107-88604129 ACTAGGTTGTTACCATCGAAAGG + Intergenic
1044622329 8:94202552-94202574 AGTAGCTTGTTACTTGTGGCTGG - Intronic
1047767210 8:127999763-127999785 ACAAGTTTGTTAAAAGTGGATGG - Intergenic
1051359866 9:16272479-16272501 AATAGTTTGCTAATAGTGGAAGG - Intronic
1052582638 9:30378532-30378554 TCTAAGTTGTTACTATTGTAGGG + Intergenic
1058562275 9:106242814-106242836 ACTAGGCTGTAACTAGGGCAAGG - Intergenic
1062494333 9:136824674-136824696 ACTAGTGGGTTACTAGTGGGAGG + Intronic
1186100290 X:6148881-6148903 AATAGGCTGTGACTTGTGGATGG + Intronic