ID: 1133780613

View in Genome Browser
Species Human (GRCh38)
Location 16:8936194-8936216
Sequence GATCACTAGGTTGTTACTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133780613_1133780618 24 Left 1133780613 16:8936194-8936216 CCACTAGTAACAACCTAGTGATC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1133780613_1133780617 13 Left 1133780613 16:8936194-8936216 CCACTAGTAACAACCTAGTGATC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1133780617 16:8936230-8936252 TTATTACGGCAGATACGCATGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1133780613_1133780616 12 Left 1133780613 16:8936194-8936216 CCACTAGTAACAACCTAGTGATC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1133780616 16:8936229-8936251 GTTATTACGGCAGATACGCATGG 0: 1
1: 0
2: 0
3: 0
4: 14
1133780613_1133780615 -1 Left 1133780613 16:8936194-8936216 CCACTAGTAACAACCTAGTGATC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1133780615 16:8936216-8936238 CAAAACTACAGCTGTTATTACGG 0: 1
1: 0
2: 1
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133780613 Original CRISPR GATCACTAGGTTGTTACTAG TGG (reversed) Intronic
907902358 1:58752421-58752443 TTTCACTAGGTTGTTCTTAGCGG + Intergenic
908557520 1:65271430-65271452 AATCAAAAGGTGGTTACTAGAGG - Intronic
1062781785 10:217920-217942 GATCAATAGGCTGCTGCTAGAGG + Intronic
1065309186 10:24397714-24397736 GATCACTACATGGTTATTAGTGG - Intronic
1078970889 11:16409981-16410003 GAGCAGTAGGTGGTTACCAGAGG + Intronic
1080484070 11:32686140-32686162 GAGGACTAGGGTGTTAGTAGTGG + Intronic
1080760986 11:35248522-35248544 GATCACTAGGGGATTACTAGTGG + Intergenic
1080761022 11:35248748-35248770 GATCACCAGGGGATTACTAGCGG + Intergenic
1082096209 11:48131811-48131833 GATCCCTAGGTTCTTTCAAGGGG + Intronic
1091022636 11:132114666-132114688 GAATAATAGGTTGTTTCTAGGGG + Intronic
1093552009 12:20423932-20423954 GCTCACTTGGTTATTACTATAGG - Intronic
1098770241 12:74541973-74541995 GATCACTAAGTAGTTTCTAGGGG - Exonic
1116566187 14:46447039-46447061 CTTCACCAGTTTGTTACTAGTGG - Intergenic
1118678596 14:68215646-68215668 AAGCACTAGGTTGTTACCACTGG + Intronic
1129087593 15:73112056-73112078 GTACACCAGGTTGTTACTACTGG - Intronic
1133780613 16:8936194-8936216 GATCACTAGGTTGTTACTAGTGG - Intronic
1155712885 18:28904745-28904767 GATCACTAGGGGGTTCCTATAGG - Intergenic
1156925796 18:42576887-42576909 GATCGCTAGGTGGTTACTTTAGG + Intergenic
1157380459 18:47210243-47210265 GAGCACAAGGTTGTTATCAGGGG + Intergenic
933902423 2:86859577-86859599 TATCACAGGGTTGTTACTGGAGG + Intronic
935991854 2:108726253-108726275 GATGACTAGTATGTAACTAGCGG - Intronic
944946268 2:204689594-204689616 AATGATTAGGTTGTTACTATTGG - Intronic
946346064 2:219111479-219111501 GATAACTAGATTTTTTCTAGGGG - Intronic
1177071375 21:16512947-16512969 GATCACTAGATTTTTAAGAGGGG - Intergenic
1182551934 22:31105271-31105293 CATCACCAGGTTGTGACTGGAGG + Exonic
949188497 3:1222371-1222393 GCTAACTAGGTTGATCCTAGGGG + Intronic
953425062 3:42789014-42789036 GATCATTAGGTTTTTACTTTGGG + Intronic
955992432 3:64642547-64642569 TATGACTTGTTTGTTACTAGCGG + Intronic
969918345 4:10512135-10512157 GATCACTTGGTTCTAACTAGAGG - Intronic
971299472 4:25429854-25429876 GCTTCCTAGGTTGTTACTAGAGG + Intergenic
972356403 4:38283039-38283061 GATCACTAGGTAGTGAACAGAGG - Intergenic
981291912 4:143086271-143086293 GATAAGTAGGTTGTAACAAGTGG + Intergenic
987503698 5:18744485-18744507 GCTCACTAGGTGATGACTAGGGG - Intergenic
989266256 5:39477396-39477418 GGTCCCTAGGTTGTGACTTGAGG - Intergenic
1000648199 5:163783721-163783743 GGCCACTAGCTTGTTACTTGGGG + Intergenic
1012538551 6:100330075-100330097 GATCACTTGGTTGTTTAAAGTGG + Intergenic
1012798157 6:103790103-103790125 AATCACAAGGTTCTTACAAGAGG + Intergenic
1015538312 6:134289324-134289346 GAACACTAGCTTGTTCATAGTGG - Intronic
1020408558 7:7865330-7865352 GAACACTCGGTTGTTATTCGGGG + Intronic
1023568283 7:41546676-41546698 GGTCACCAGGTTGTTGCTTGTGG - Intergenic
1029222018 7:98997883-98997905 GATCACTTGGTATTTATTAGTGG - Intronic
1051012670 9:12437764-12437786 GATCAGTTGGTTGTAACTATTGG + Intergenic
1191166366 X:57396417-57396439 GAGCATTAGGTTGTTAGTTGGGG + Intronic
1195661298 X:107381473-107381495 GATATTTAGGTTGTTTCTAGGGG + Intergenic
1198270212 X:135049814-135049836 GATCATATGGTTGTTACTAGAGG + Intergenic
1202062776 Y:20904843-20904865 GATCACAAGGTTCTCACTAGGGG + Intergenic