ID: 1133780618

View in Genome Browser
Species Human (GRCh38)
Location 16:8936241-8936263
Sequence GATACGCATGGGCCAACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133780614_1133780618 11 Left 1133780614 16:8936207-8936229 CCTAGTGATCAAAACTACAGCTG 0: 1
1: 0
2: 2
3: 16
4: 135
Right 1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1133780613_1133780618 24 Left 1133780613 16:8936194-8936216 CCACTAGTAACAACCTAGTGATC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1133780612_1133780618 28 Left 1133780612 16:8936190-8936212 CCTTCCACTAGTAACAACCTAGT 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133780618 Original CRISPR GATACGCATGGGCCAACACC TGG Intronic
902632753 1:17715395-17715417 GATAGGCCTGGGCCAAATCCTGG - Intergenic
915735262 1:158080635-158080657 TACACGCCTGGGCAAACACCTGG + Intronic
916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG + Intergenic
916476812 1:165177466-165177488 GATACCCATGCCCTAACACCTGG + Intergenic
1101991801 12:109491880-109491902 GATACGTTTGGGCCAACCCCGGG - Intronic
1103723211 12:122985689-122985711 GCTGCGCCTGGGCCCACACCTGG + Exonic
1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG + Intronic
1114616988 14:24073546-24073568 AATACTCAAGGGCCAGCACCCGG - Exonic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1125193425 15:37019703-37019725 GAAACGCAGGGCCCAACAGCAGG + Intronic
1130879775 15:88045029-88045051 GATGGGCAGGTGCCAACACCTGG - Intronic
1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG + Intronic
1136015199 16:27393965-27393987 GACAGGCATGAGCCACCACCTGG - Intergenic
1139632227 16:68237614-68237636 GAGACGCATGGGCCAGTGCCCGG - Intronic
1148534633 17:48429594-48429616 GATCCCCATGGGCCAAGGCCAGG - Intronic
1161353765 19:3807760-3807782 CATACGCATGGGCACACACATGG - Intronic
1161714876 19:5869926-5869948 TATAGGCATGTGCCAGCACCTGG - Intronic
1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG + Intronic
926704835 2:15829651-15829673 TATAGGCATGAGCCACCACCAGG - Intergenic
942267022 2:174238351-174238373 TATAGGCATGCGCCACCACCAGG - Intronic
945780402 2:214164378-214164400 GATACACATGAGCAGACACCTGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG + Exonic
961666230 3:128494567-128494589 CAGACACATGGGCAAACACCTGG - Intergenic
973871692 4:55172806-55172828 AATAGGCAGGGGCCAAGACCAGG - Intergenic
988307320 5:29509348-29509370 GAGAGGCATGTGCCAACTCCGGG - Intergenic
989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG + Intronic
991395918 5:66205331-66205353 GATACACAAGGGCACACACCAGG - Intergenic
1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG + Intergenic
1017345258 6:153372146-153372168 TATAGGCATGAGCCACCACCTGG - Intergenic
1018621606 6:165734269-165734291 GACACGCCTGGGCCACCTCCAGG + Intronic
1020495092 7:8841189-8841211 GATACTAATGTGCAAACACCAGG + Intergenic
1026982360 7:74534270-74534292 GGAAAGCATGGGCCAACCCCTGG - Intronic
1029735009 7:102460774-102460796 GATAGGCACGGGCCAACCCCTGG - Intronic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1040551750 8:48443245-48443267 CATACACATGGGCCAACCCTGGG + Intergenic
1042571824 8:70173640-70173662 GATAAGCAAGGGCCAACACTGGG + Intronic
1049010918 8:139886859-139886881 GAATCGCATTGGCCAACCCCAGG + Intronic
1060110545 9:120903667-120903689 GATAGGTGTGGGCCACCACCAGG + Exonic
1193408065 X:81127678-81127700 GAAACACATGGGCCATCAACTGG + Intronic
1199758762 X:150889333-150889355 GAAACCCATGGGCTAACCCCAGG - Intronic