ID: 1133780630

View in Genome Browser
Species Human (GRCh38)
Location 16:8936304-8936326
Sequence CAAGGTGAACTGATGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133780630_1133780639 0 Left 1133780630 16:8936304-8936326 CCCGCCCCCATCAGTTCACCTTG 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1133780639 16:8936327-8936349 AACTCCCTCTGGGTTCTGCATGG 0: 1
1: 0
2: 1
3: 21
4: 187
1133780630_1133780637 -10 Left 1133780630 16:8936304-8936326 CCCGCCCCCATCAGTTCACCTTG 0: 1
1: 0
2: 1
3: 25
4: 207
Right 1133780637 16:8936317-8936339 GTTCACCTTGAACTCCCTCTGGG 0: 1
1: 1
2: 1
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133780630 Original CRISPR CAAGGTGAACTGATGGGGGC GGG (reversed) Intronic
900308915 1:2024202-2024224 GCAGGTGAGCAGATGGGGGCCGG + Intronic
900888462 1:5432078-5432100 CAAGCTCAACTGATGGCTGCAGG + Intergenic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
902371425 1:16009554-16009576 TCAGGTGAACTGATGGGGTGTGG - Intergenic
902648968 1:17824035-17824057 CATGGTGGACTGTTGGGGGTGGG + Intronic
904658170 1:32064926-32064948 CAAAGTAAACTAATGTGGGCTGG - Intergenic
906717996 1:47984512-47984534 CAAGGTGAACTGGAGGTGGAGGG + Intronic
907047554 1:51308966-51308988 CAGGGTGTTCTGGTGGGGGCAGG - Intronic
908363132 1:63389948-63389970 CATGTTGAGCTGATGGGAGCTGG + Intronic
910568584 1:88675128-88675150 CAACTTGAACTGGTGGGGACTGG + Intergenic
912357420 1:109066518-109066540 AAAGGTGTTCTGCTGGGGGCAGG - Intronic
912550785 1:110483945-110483967 CAAGGTGAACTTCTGGGGAAGGG - Intergenic
915545758 1:156596582-156596604 CAAGGAGCAATGGTGGGGGCTGG - Intronic
917088031 1:171323213-171323235 GAAGATGAATAGATGGGGGCTGG + Intronic
919080536 1:192860549-192860571 CAAGGAGAAGTGATGGATGCAGG - Intergenic
920719136 1:208370628-208370650 CTAGGAGAACTGATTGAGGCAGG - Intergenic
923215683 1:231845868-231845890 CAAGGTGAAGTGAGGTGGGATGG + Intronic
1063815511 10:9767235-9767257 CAATGTGACCTGATGGAGGTGGG + Intergenic
1066554567 10:36597168-36597190 CAATGTGTAATGATGGTGGCAGG + Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1069871887 10:71538139-71538161 CATGGAGACCTGGTGGGGGCGGG - Intronic
1070362548 10:75705015-75705037 GAAGGTGAACTATTGGGGGCTGG + Intronic
1073367119 10:102952266-102952288 AAATGTTAAATGATGGGGGCCGG + Intronic
1074696239 10:116052207-116052229 CAAGGGGAGGTGGTGGGGGCAGG - Intergenic
1075091941 10:119448735-119448757 CAATGTGAGCTGCTGGGGGAGGG - Intronic
1077207454 11:1351877-1351899 GAAGGGGAATTGGTGGGGGCAGG - Intergenic
1077207537 11:1352076-1352098 GAAGGGGAATTGGTGGGGGCAGG - Intergenic
1077207712 11:1352494-1352516 GAAGGGGAATTGGTGGGGGCAGG - Intergenic
1077211518 11:1372863-1372885 CAAGGTCAAGTGATGGAGCCGGG + Intergenic
1079102327 11:17549380-17549402 CAAGGTGGAGTGAGGGGGGATGG + Intronic
1080752646 11:35165141-35165163 CAAGCTGAGCTAATGGGGGCTGG - Intronic
1084236044 11:67788528-67788550 CAGGGGGAACAGATGTGGGCAGG + Intergenic
1084500858 11:69534340-69534362 CCAGGTGCACTGATGGGGCCGGG - Intergenic
1088401459 11:109425029-109425051 AAAGGTGTACGGGTGGGGGCGGG - Exonic
1088883564 11:113989983-113990005 CATGGTGAGCTGCTGGGGGTGGG - Exonic
1089066474 11:115665793-115665815 CAGGGAGCACTGCTGGGGGCTGG + Intergenic
1089260200 11:117219038-117219060 CAAGGTGAACAGGTGTTGGCAGG - Exonic
1089464156 11:118673360-118673382 CAAGGTGGACTGATGCTGGTAGG - Intronic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1092940252 12:13401355-13401377 AAAGGTGATGTGCTGGGGGCGGG + Intergenic
1093037149 12:14342836-14342858 CAAGGTATAATGATGTGGGCAGG + Intergenic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1096591835 12:52665234-52665256 CAAGGTGAGCGGATAGGGACTGG - Intergenic
1097911393 12:64973614-64973636 CTAGGTGAAATGCTGGGGACTGG + Intergenic
1099698993 12:86060946-86060968 CTGGGTGAAATGATGGGCGCAGG - Intronic
1100607408 12:96162985-96163007 GGAGGAGAACTGATGGGGACTGG - Intergenic
1100705277 12:97194024-97194046 CAAGGTGAAATCATGGGGTAGGG + Intergenic
1100893504 12:99153466-99153488 CAAGGGGAACTGATGAGCACTGG + Intronic
1101599252 12:106194513-106194535 CAAGCAGAACTGATGGGGGCAGG + Intergenic
1101659591 12:106753926-106753948 CAAGGGGGACTGGTGGAGGCAGG + Intronic
1102475612 12:113186350-113186372 CTATGTGTACTGATGGGGGTGGG - Intronic
1103180623 12:118908191-118908213 CAAGATGAACTGATTTTGGCTGG + Intergenic
1104450797 12:128866914-128866936 GAAGGTGACCTGAAGGTGGCTGG - Intronic
1105826273 13:24126190-24126212 CAGGATGAAGTCATGGGGGCAGG + Intronic
1106698182 13:32200899-32200921 AAATGGGAACTGATGAGGGCTGG - Intronic
1106883700 13:34159746-34159768 CAAGATGTACTGATAGAGGCTGG + Intergenic
1107664821 13:42677841-42677863 CAGGGTGAAGTCATGGGGGAGGG + Intergenic
1108083484 13:46761238-46761260 CAGGGTGAGCTGATCAGGGCAGG - Intergenic
1110345645 13:74444545-74444567 CAAGGAGAGCTGAAGGTGGCAGG + Intergenic
1110858954 13:80326857-80326879 CAAGGGGAACTGATAGGGGGTGG + Intergenic
1113181733 13:107636114-107636136 CCAAGTGCACTGATGAGGGCAGG - Intronic
1114892757 14:26945894-26945916 TACAGAGAACTGATGGGGGCTGG + Intergenic
1116040890 14:39685362-39685384 CATGGAGAACTGATGGGGGATGG - Intergenic
1117221948 14:53615324-53615346 TAAGGTGAACAGATTGAGGCAGG + Intergenic
1117378789 14:55139340-55139362 GAAGGGGAACTGATGGGGGAGGG + Intronic
1117652686 14:57923402-57923424 CCAGGTGAACTGATCCTGGCTGG + Intronic
1119256021 14:73197859-73197881 GCAGGTGAACTGGTGGGGGTGGG - Intronic
1119598691 14:75959471-75959493 TAAGAGGAACTGTTGGGGGCCGG + Intronic
1123482018 15:20640854-20640876 CTAGGTGCACTGATAGGGTCCGG + Intergenic
1123635994 15:22359511-22359533 CTAGGTGCACTGATAGGGTCCGG - Intergenic
1124003798 15:25780385-25780407 CCAGGTGAACTGACAGGGGCAGG - Intronic
1124126560 15:26942695-26942717 GAATGTGAACTGAGGAGGGCAGG - Intronic
1127871582 15:63078305-63078327 TAATGTAAACTGCTGGGGGCTGG + Intergenic
1128028696 15:64460911-64460933 TGAGGGGATCTGATGGGGGCCGG + Intronic
1129292784 15:74581172-74581194 TGAAGAGAACTGATGGGGGCGGG - Intronic
1130062481 15:80579853-80579875 GAAGGTGAACTGAAGGTGGGAGG + Intronic
1130066806 15:80611699-80611721 CAAGATGACCTGATGGCGGCAGG + Intergenic
1130301381 15:82681618-82681640 CCAGGTGCCCTGATGGGGGGAGG + Intronic
1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG + Intronic
1132875114 16:2133725-2133747 CAGGGTGACCTCATGTGGGCAGG - Intronic
1133780630 16:8936304-8936326 CAAGGTGAACTGATGGGGGCGGG - Intronic
1133834761 16:9357990-9358012 GAAGTTGGACTGATTGGGGCTGG + Intergenic
1134063086 16:11210742-11210764 CAAGGTGGTGTGAGGGGGGCTGG - Intergenic
1134326629 16:13213629-13213651 CAAGGTTAATTAATGGGGGCGGG + Intronic
1134411319 16:14004881-14004903 CCAGGTGGACAGATGGGAGCTGG - Intergenic
1134519873 16:14913665-14913687 CAGGGTGACCTCATGTGGGCAGG + Intronic
1136290832 16:29270419-29270441 ATAGGTGAACTGATGGAGACTGG + Intergenic
1136356168 16:29745892-29745914 CAAGGTGAGTTGAGGGGTGCAGG - Exonic
1136520895 16:30795093-30795115 CAGGGAGAAGTGAAGGGGGCTGG - Intergenic
1137270560 16:46900051-46900073 CCAGGTGCACTGAGGGGGTCAGG - Intronic
1137412426 16:48240508-48240530 CAATGTGGCCTGATGGGGGCAGG + Intronic
1139022228 16:62763778-62763800 CATGGTGAATAGATGGGGACTGG - Intergenic
1139375054 16:66491641-66491663 CAGGGTGGAGGGATGGGGGCGGG + Intronic
1140844667 16:78874952-78874974 CAACGTGAAGTCATGGGGGCAGG - Intronic
1141234386 16:82201919-82201941 AAAAGTGAGCTTATGGGGGCTGG - Intergenic
1141501778 16:84449628-84449650 CCAGGTGATCTGAGAGGGGCTGG + Intronic
1142623386 17:1178845-1178867 CAAGGTGCGGTGGTGGGGGCGGG + Intronic
1143057057 17:4170331-4170353 GAAGGAGAGCTGATAGGGGCTGG + Intronic
1144795497 17:17888649-17888671 GAAAGTGAACTGATTGGGGTGGG - Intronic
1144997365 17:19279371-19279393 CAAGGTCACCAGATGGGGGAGGG + Intronic
1146889728 17:36498653-36498675 CAAGGTGAACTGAAGGCACCTGG + Intronic
1147180334 17:38680694-38680716 AAAGGTTAAATGATGGTGGCTGG - Intergenic
1147651187 17:42062861-42062883 CCAGGTGCACTGTGGGGGGCGGG - Exonic
1148896033 17:50839809-50839831 CCAGGTGAAGTGATAGCGGCAGG - Exonic
1151345804 17:73500531-73500553 GAAGGAGAACTGAGGGGGGATGG - Intronic
1151425006 17:74025302-74025324 CAAGATGAAGTCATGGAGGCGGG - Intergenic
1152119473 17:78409456-78409478 AAAGGTGAACTGATGGTGAGAGG + Intronic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1153728382 18:7980999-7981021 CAAGGGGAACTGATGGAGAGGGG - Intronic
1154032402 18:10765380-10765402 AAAGGTGAAGTGGTGTGGGCTGG + Intronic
1155250770 18:23951391-23951413 TGAGTTGAGCTGATGGGGGCGGG + Intronic
1156284657 18:35679957-35679979 CATGGTGAACAGATGGGAGGGGG - Intronic
1157775340 18:50390604-50390626 AAAGGAGAACTGATGGGGTAGGG - Intronic
1161302024 19:3547436-3547458 CAAGGTGAGCAGATTGGGGCGGG - Exonic
1162037313 19:7948314-7948336 GAAGGTGAAATGATGGCAGCTGG + Intergenic
1163138556 19:15331662-15331684 GAAGGTGAAGAGATGGGGGTGGG + Intronic
1163213111 19:15856475-15856497 GAAGCTGAAATGATGGAGGCGGG - Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166675645 19:44739035-44739057 CCAGGTGATGTCATGGGGGCTGG - Intergenic
1166755393 19:45187525-45187547 CAAGGAGACCAGATGGGGCCAGG - Intronic
1167289519 19:48616707-48616729 GAAGGTGAGCTGGCGGGGGCTGG - Exonic
925941862 2:8828278-8828300 CCAGGTGACCTGACGGGGTCAGG - Intronic
927884026 2:26707486-26707508 CAAGGTGAAATGTTGAAGGCTGG - Intronic
928286601 2:29995455-29995477 AAAGGAGAAGAGATGGGGGCAGG + Intergenic
929018614 2:37527395-37527417 CCAGGTGAACTGGTTGGGGGAGG + Intergenic
929088731 2:38194065-38194087 GAAGGGGAAGTGATGGGGGTGGG - Intergenic
929906142 2:46048395-46048417 CATGGGAAATTGATGGGGGCTGG - Intronic
930586806 2:53276844-53276866 CAAGGGGAAATGATGGGGCATGG + Intergenic
932467732 2:71934342-71934364 CAAGGTGACCTGTTGAAGGCTGG + Intergenic
933938185 2:87223928-87223950 CAAGTGGAACTGATGTGGTCAGG + Intergenic
934581380 2:95443395-95443417 CAAGTTGCACTAATGGGGTCAGG - Intergenic
934598070 2:95633319-95633341 CAAGTTGCACTAATGGGGTCAGG + Intergenic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
936006254 2:108891864-108891886 CCAGGTGATGTGATGGTGGCTGG + Intergenic
936354951 2:111741847-111741869 CAAGTGGAACTGATGTGGTCAGG - Intergenic
938086778 2:128407088-128407110 CCAGGTGGACGGATGGGTGCTGG + Intergenic
938227145 2:129625923-129625945 CAATGAGAACCGAGGGGGGCTGG + Intergenic
941242477 2:163056509-163056531 CAATGGGGACTGTTGGGGGCTGG + Intergenic
941528297 2:166632671-166632693 CAAGCTGCACTGACTGGGGCTGG + Intergenic
941889778 2:170567973-170567995 CAAGGTGCACTGATGGGTCATGG + Intronic
942215193 2:173712582-173712604 TCAGGTGCAATGATGGGGGCAGG + Intergenic
947941201 2:234057152-234057174 CAAGGTAAACAGATTGGGGCAGG - Intronic
947983067 2:234426331-234426353 CAAGGTGACCTGATAGGGGAAGG - Intergenic
948881914 2:240863052-240863074 CCTGGTGCACTGATGGTGGCAGG + Intergenic
1170297454 20:14843996-14844018 CAAAGTGAACTAATGGAGGCAGG - Intronic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1175279054 20:57790574-57790596 CAAGATGGCCTGATGGGGGCTGG - Intergenic
1178088931 21:29141070-29141092 CAAGAAGAACTTATTGGGGCTGG - Intronic
1178131118 21:29573552-29573574 CAAAGTGAACTTAAGGGGCCGGG + Intronic
1179314009 21:40225263-40225285 CAAGGTCAAGTGGTTGGGGCAGG - Intronic
1179812111 21:43878370-43878392 CAATGTGAACTGAAGCGGGCAGG - Intronic
1184068071 22:42131337-42131359 CAAGGTGAAGTGAAGGGACCAGG - Intergenic
1184070806 22:42145010-42145032 CAAGGTGAAGTGAAGGGACCAGG - Intergenic
1185362154 22:50414780-50414802 CTAGGTGGAGAGATGGGGGCCGG - Intronic
950702788 3:14761690-14761712 AAAGGGGAACTGAGGGGAGCAGG + Intronic
951643013 3:24856882-24856904 CACATTGAAATGATGGGGGCAGG + Intergenic
953863330 3:46563770-46563792 TCAGCTGAACTCATGGGGGCCGG - Intronic
954331975 3:49895984-49896006 CAAGCTGCAGGGATGGGGGCAGG + Exonic
954584260 3:51720261-51720283 GAAGGGGAAATGAGGGGGGCAGG - Intergenic
955148211 3:56341246-56341268 TAAGGTGAACTGGTTGGGGCTGG + Intronic
955706619 3:61734076-61734098 CAAAGTGAACAGATGTTGGCTGG - Intronic
958962168 3:100521181-100521203 CAATGTGAATGGATGGGGTCTGG + Intronic
960056207 3:113278340-113278362 CAAGGTGAACAGCTGGGGCAAGG - Intronic
960165878 3:114400761-114400783 CCAGGTGAAATCATGTGGGCTGG - Intronic
960814448 3:121658552-121658574 CAAGACGAATTGATGTGGGCTGG + Intronic
961411146 3:126721293-126721315 CAAAGTGAACCTATGGCGGCAGG + Intronic
962278102 3:134030558-134030580 CAAGGTGAAAAGGTGGGGGCTGG + Intronic
963591713 3:147269359-147269381 CACAGTCAACTGATGGGGGGTGG + Intergenic
963954217 3:151235272-151235294 CTTTGTAAACTGATGGGGGCAGG + Intronic
964027680 3:152097649-152097671 CAAAGTGAAATGTTGGGAGCTGG + Intergenic
967187926 3:186961269-186961291 CAAGATCAAGTGATGGGGCCGGG - Intronic
970899515 4:21142664-21142686 CAAGGTGAAGAGATGCTGGCAGG - Intronic
973158447 4:46987479-46987501 CAGTGTGAACTTATGAGGGCAGG + Intronic
973844107 4:54893472-54893494 TAAGGTGGACTGAAGGAGGCTGG - Intergenic
976583368 4:86766750-86766772 CAAAGAGATCTGATGGGGGAGGG + Intronic
978761852 4:112361602-112361624 AAAGGTCATCAGATGGGGGCAGG - Intronic
981778420 4:148397165-148397187 CACGGGGAAATGGTGGGGGCTGG - Intronic
981811828 4:148784265-148784287 CAGGATGGACTGATGGTGGCGGG + Intergenic
981831017 4:149001959-149001981 CAAGCTGAAATGCTGGTGGCTGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
984742195 4:183175940-183175962 CAAGGTGAAGTGAGGTGGGCTGG - Intronic
987318243 5:16744379-16744401 CAAGGTGTAGTGATGAGGCCTGG + Intronic
990942387 5:61215748-61215770 CGAAGTGAACTAATGGGGCCAGG + Intergenic
993350279 5:86842082-86842104 AAAGGTCAAGTTATGGGGGCCGG + Intergenic
993884319 5:93398236-93398258 CAAGGTGAAGTGTTGGCTGCAGG + Intergenic
997040389 5:130246191-130246213 CAATGAGAACATATGGGGGCAGG - Intergenic
997408241 5:133669533-133669555 CAAGCCGAGCTGCTGGGGGCAGG - Intergenic
997851006 5:137332433-137332455 CTAGGTGCTCTGTTGGGGGCTGG - Intronic
998003610 5:138642986-138643008 CAGGGTGAGCTACTGGGGGCTGG - Intronic
998093170 5:139382631-139382653 TAGGGTGAAGTGATGGGGACAGG + Intronic
1001945595 5:175775074-175775096 ACAGATGCACTGATGGGGGCCGG - Intergenic
1001955930 5:175848165-175848187 TAAGGAGATCTGAGGGGGGCGGG + Intronic
1005398765 6:25410280-25410302 CAAGTTGAAATGATGTAGGCTGG + Intronic
1006613498 6:35309987-35310009 GAAGGTGAATTGAGGGGGACAGG - Intronic
1007779956 6:44246976-44246998 CAAGGTGGGCTGGTGGCGGCAGG + Intronic
1007843326 6:44734516-44734538 TGAGGTGAAATGTTGGGGGCTGG - Intergenic
1010455284 6:76047605-76047627 CAAGGTGAACTGGAGAGGGGAGG - Intronic
1010583277 6:77626106-77626128 GAAAGTGAATTGATGGGGGTAGG - Intergenic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1014804442 6:125813239-125813261 CAAGGTGCAGTGAAGGGGGTGGG + Intronic
1017958010 6:159195340-159195362 CAAGGTGAAGTGATTGTGGTGGG + Intronic
1019631423 7:2051771-2051793 CAAGGTGACCTGGCGGGCGCAGG - Intronic
1019738170 7:2660567-2660589 CAAGGGGAGGGGATGGGGGCGGG - Intronic
1019941758 7:4297675-4297697 CAAGGTAGACTGTGGGGGGCGGG - Intergenic
1020749289 7:12120168-12120190 CATAGTGAACAGATGGGGGATGG + Intergenic
1021049201 7:15961549-15961571 CAATGAGAACTTATGGGCGCAGG + Intergenic
1024668439 7:51567914-51567936 CAAGGGGCACTCATGGGGGATGG - Intergenic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1030237865 7:107286361-107286383 CATGGTGGGCTGATGGAGGCTGG - Intronic
1033630053 7:143148792-143148814 CCTGGTGGACTGATGAGGGCAGG - Intergenic
1038528565 8:28297737-28297759 CCAAGTGAACTGAAGGGGTCTGG - Intergenic
1040387675 8:46924452-46924474 CCAGGTGAAGTGATGGGTGATGG - Intergenic
1042952600 8:74217222-74217244 AAAGTTGAATTGATGGGAGCTGG + Intergenic
1043799643 8:84591711-84591733 CATCGTGAACTGAAGAGGGCAGG + Intronic
1043827549 8:84947875-84947897 CAAGATGGAATAATGGGGGCTGG + Intergenic
1044753328 8:95436947-95436969 CAAGGGGATCTCATGGGGGTGGG - Intergenic
1046937239 8:119896307-119896329 CAAGGTGAGCAGGTGGGAGCTGG + Intronic
1047107418 8:121748330-121748352 GAAGGGGAACTGATGGGGCTTGG + Intergenic
1048357751 8:133667396-133667418 AAGGGTGAACGGATGGGGGTTGG + Intergenic
1049794460 8:144490209-144490231 AAAGGTGAGCTGCTGGGGCCGGG + Exonic
1056569941 9:87806204-87806226 CAATGTCAACTGATGAGAGCCGG + Intergenic
1057604506 9:96489418-96489440 CAGTGTGACCTGATGGGGGCGGG - Intronic
1059765435 9:117379421-117379443 CAAGGTGAAGTGATGGTGACTGG + Intronic
1061281648 9:129601138-129601160 CAAGGAGAACTGTGGGGAGCTGG + Intergenic
1062205182 9:135332551-135332573 CAAGCTGCAGTGCTGGGGGCAGG + Intergenic
1187574488 X:20540170-20540192 CACGGGGACCTGTTGGGGGCTGG - Intergenic
1187593754 X:20747559-20747581 CAAGGTAATCCGAAGGGGGCAGG - Intergenic
1189321713 X:40091120-40091142 CCAGGGGAACTGTTGGGGGATGG - Intronic
1189423299 X:40875930-40875952 CAAGGTGAAATGATTTGGGGAGG - Intergenic
1190728440 X:53208054-53208076 GAAGGTGGGGTGATGGGGGCAGG + Intronic
1198296621 X:135293474-135293496 CAGGGTGAATTGATGGTGGTGGG - Intronic
1198947627 X:142031872-142031894 CAAGCTGAACTGCCTGGGGCTGG + Intergenic
1200160589 X:154006217-154006239 CAGGGAGACCTGATGGGAGCTGG - Intergenic