ID: 1133781627

View in Genome Browser
Species Human (GRCh38)
Location 16:8943430-8943452
Sequence CGAGCTGCACAGATGCAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133781627 Original CRISPR CGAGCTGCACAGATGCAGTT AGG Intronic
900692394 1:3988417-3988439 TGAGTTGCCCAGATGCAGTTAGG + Intergenic
903578931 1:24356769-24356791 AGAGCTGCAGTGATGGAGTTAGG - Intronic
905163467 1:36058966-36058988 GGAGCTGCACAGATTCATGTGGG + Exonic
908984784 1:70004614-70004636 CCAGCTGCCTAGCTGCAGTTGGG + Intronic
915475061 1:156148351-156148373 CGAGATGCAGAGAGGCAGTGAGG + Intronic
922630663 1:227106554-227106576 CCAGCTTCACAGAATCAGTTAGG + Intronic
924934406 1:248755908-248755930 CGAGCTGCACAGATGCCAAAGGG - Intergenic
1063179700 10:3586614-3586636 GGAGCTGCACAGAGGCATTCGGG - Intergenic
1068705234 10:60068926-60068948 CCAGCTGCACAGTTAAAGTTAGG - Exonic
1080643928 11:34174577-34174599 CGAGCGGCTCAGATTCAGCTGGG + Intronic
1080754246 11:35180317-35180339 TTTGCTGCACAGATGGAGTTGGG - Exonic
1086085193 11:82946082-82946104 CCAGGTCCACAGCTGCAGTTTGG + Intronic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1091621627 12:2093474-2093496 TGAGCTGCACAGATGGAAGTGGG + Intronic
1092104104 12:5908711-5908733 TGAGCGGGACAGATGCACTTAGG - Intronic
1094203712 12:27818474-27818496 CCAGCTGCACAGCTGCATGTGGG - Intergenic
1096110223 12:49024375-49024397 CAACCTGCTCAGATGCACTTGGG - Intronic
1097076231 12:56397003-56397025 CCAGCTGCAGAGATGCAGAGAGG - Intergenic
1101764114 12:107682684-107682706 CCAGATCCACAGCTGCAGTTTGG + Intergenic
1104200044 12:126579706-126579728 TGAGCTGCACATATGGAGGTAGG - Intergenic
1107567813 13:41624310-41624332 CTAGCTGCATAGATTGAGTTAGG - Intronic
1107577510 13:41743039-41743061 AGAGCTGCACAGAACAAGTTGGG + Intronic
1108320071 13:49281188-49281210 TTAGCTGAACAGTTGCAGTTAGG - Intronic
1112621916 13:101061940-101061962 TGAACTGCACACATGCAGGTTGG - Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1126575039 15:50188211-50188233 TGAGCTGAACAAATGCAGTGGGG + Intronic
1128307612 15:66610249-66610271 TGAGCAGCACAGAGGCACTTGGG - Intronic
1133781627 16:8943430-8943452 CGAGCTGCACAGATGCAGTTAGG + Intronic
1137971962 16:52994496-52994518 TGAGCTTCAGATATGCAGTTTGG - Intergenic
1138390645 16:56667965-56667987 CCAGCGGCACAGGAGCAGTTGGG + Exonic
1139272474 16:65697226-65697248 TGAGTTGCACAGATTCAGCTGGG - Intergenic
1151327420 17:73387888-73387910 CGAGCTGCCCAGCGGCAGGTGGG - Exonic
1152529521 17:80909090-80909112 GGAGCTGCACAGACACAGTTTGG - Intronic
1152866915 17:82729615-82729637 CGAGCAGCACAGGTGCTGTCGGG - Intronic
1152866928 17:82729662-82729684 CGAGCGGCACAGGTGCTGTCGGG - Intronic
1152866941 17:82729709-82729731 CGAGCAGCACAGGTGCTGTCGGG - Intronic
1153738361 18:8096435-8096457 CCAGCTGCACAGAAGCCATTCGG + Intronic
1156375874 18:36514956-36514978 CCAGCTGCATAGAGGGAGTTCGG + Intronic
1157313151 18:46567355-46567377 CCAGCTGCAAAGAGGCACTTAGG - Intronic
1160327978 18:77968134-77968156 AGGTCTGCACACATGCAGTTGGG + Intergenic
1160406385 18:78649318-78649340 GGAGCTGCAGAGATGCGGATAGG + Intergenic
1160806820 19:995632-995654 CCAGCTGCCCTGATGCAGTGTGG - Intronic
925207629 2:2020917-2020939 GGAGCTGCTCAGAGGCAGCTGGG - Intronic
926349412 2:11981821-11981843 TGACCTGCGCAGATGTAGTTTGG + Intergenic
928087134 2:28352902-28352924 GGAGCTGCACAGACGAGGTTTGG + Intergenic
928328303 2:30337416-30337438 CGGGCTGGACAGGTGCAGTTGGG - Intergenic
932131182 2:69188676-69188698 CTAGCTTCACAGAAGCAGTTGGG + Intronic
934581793 2:95447806-95447828 TGAGATGTACAAATGCAGTTGGG - Intergenic
934597657 2:95628908-95628930 TGAGATGTACAAATGCAGTTGGG + Intergenic
942085358 2:172438341-172438363 TGAGGGGCACAGATGCAGGTAGG + Intronic
945328335 2:208509817-208509839 GAAGCAGCACAGGTGCAGTTTGG - Intronic
947787408 2:232835982-232836004 CAAACAGCACTGATGCAGTTAGG + Intronic
947983038 2:234426126-234426148 CGCCCTGCACACCTGCAGTTAGG - Intergenic
948732656 2:239976922-239976944 AGAGGTGCACAGCTGCTGTTTGG - Intronic
1172676573 20:36676968-36676990 TGAGATCCACAGCTGCAGTTTGG - Intronic
1174124891 20:48297144-48297166 CGAGGTGCAGAGATGGAGATGGG - Intergenic
1175192115 20:57218382-57218404 GGAGCTGCACAGCTGGTGTTTGG + Intronic
1179146599 21:38773931-38773953 TGAGCTGCACACATGCAGGATGG + Intergenic
1180593133 22:16957404-16957426 CATGCTGCCCAGATGCAGTGAGG - Intergenic
949404805 3:3702961-3702983 GGAGGGGCAGAGATGCAGTTTGG + Intronic
950454018 3:13082030-13082052 GGAGCTGCACCCATGGAGTTGGG - Intergenic
951363075 3:21747740-21747762 TGAGCTGCCCAGTTACAGTTTGG - Intronic
954430649 3:50469256-50469278 CTAGCTGCAGAGATGCTGTTGGG - Intronic
959274052 3:104254763-104254785 GGAGCTGCACAGAAACAGCTAGG - Intergenic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
962328892 3:134460221-134460243 CCAGCTGCACACAGGCATTTTGG + Intergenic
965272633 3:166638449-166638471 CTAGGTTCACAGATGCAGCTTGG - Intergenic
966708642 3:182947377-182947399 AGAGCTGCACAAAAACAGTTTGG + Intronic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
972427372 4:38946321-38946343 CGCACTACACAGGTGCAGTTAGG - Intergenic
975849110 4:78553175-78553197 CTAGCTGCCTAGATGCAGTAGGG + Intronic
978012753 4:103707924-103707946 CGAGCTGCAAGGAGGCAGTGAGG + Intronic
978533945 4:109741263-109741285 AGAGTTGCAGAGATGCAGCTTGG + Intronic
993998669 5:94752353-94752375 CAAGCTGATCAGCTGCAGTTTGG - Intronic
994881368 5:105501485-105501507 CCAGCTGCACAGCTGCTGCTAGG - Intergenic
996550931 5:124729262-124729284 TGAGCTTCACAGCTGCAGTTTGG + Intronic
1001541623 5:172543609-172543631 TGTGCTGCACAGATCTAGTTTGG - Intergenic
1003727789 6:8785352-8785374 TGCGCTGCACACATGCACTTTGG - Intergenic
1003898550 6:10631724-10631746 AGAGCTACACAGTTGGAGTTTGG + Intergenic
1006726572 6:36203429-36203451 CTACCTGCACAAATGCTGTTGGG + Intronic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1010111250 6:72236323-72236345 TCAGCTGCAGAGATGCATTTAGG + Intronic
1016061155 6:139631996-139632018 CTAGCTTCACAGATTAAGTTTGG + Intergenic
1020553262 7:9635201-9635223 ACAACTGCACAGATGAAGTTTGG - Intergenic
1022242933 7:28530386-28530408 CGAGCTGCTCAGGGGCAGCTTGG + Intronic
1026635731 7:72080169-72080191 CGTTCTGCACAGGTGTAGTTGGG - Intronic
1029570913 7:101368507-101368529 CTAGCAGCTCAGAGGCAGTTTGG + Intronic
1031067060 7:117116433-117116455 AGAGCTGCACAGATCCAAATGGG - Intronic
1031998216 7:128246760-128246782 GGAGCTGCACAGATGAAATGTGG - Intronic
1038395162 8:27241191-27241213 CGAGCTGAACAAATGCACCTCGG - Exonic
1040605909 8:48930936-48930958 CTGGTTGTACAGATGCAGTTTGG + Intergenic
1044867068 8:96582039-96582061 CGAGCTGCACCATGGCAGTTGGG - Intronic
1050330933 9:4545517-4545539 GGGGCAGCACAGCTGCAGTTGGG - Intronic
1051868438 9:21708895-21708917 CCAGCTGCAGGGATGCAGTGGGG + Intergenic
1053414432 9:37938141-37938163 GAGGCTGCACAGATGCAGGTAGG - Intronic
1055342536 9:75299932-75299954 GTAGCAACACAGATGCAGTTGGG - Intergenic
1187433906 X:19249431-19249453 CCATCTGCACAGTTGAAGTTGGG + Intergenic
1193919455 X:87407248-87407270 TGGGATGCACAGCTGCAGTTTGG + Intergenic