ID: 1133784335

View in Genome Browser
Species Human (GRCh38)
Location 16:8963320-8963342
Sequence GGCCGGGGCTGCGAGCCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 492}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133784328_1133784335 -6 Left 1133784328 16:8963303-8963325 CCTCGCCTGCGGCCGGGGGCCGG 0: 1
1: 0
2: 2
3: 34
4: 293
Right 1133784335 16:8963320-8963342 GGCCGGGGCTGCGAGCCCGGCGG 0: 1
1: 0
2: 4
3: 31
4: 492
1133784324_1133784335 0 Left 1133784324 16:8963297-8963319 CCTGGGCCTCGCCTGCGGCCGGG 0: 1
1: 0
2: 4
3: 20
4: 357
Right 1133784335 16:8963320-8963342 GGCCGGGGCTGCGAGCCCGGCGG 0: 1
1: 0
2: 4
3: 31
4: 492
1133784321_1133784335 6 Left 1133784321 16:8963291-8963313 CCGCGGCCTGGGCCTCGCCTGCG 0: 1
1: 0
2: 0
3: 26
4: 354
Right 1133784335 16:8963320-8963342 GGCCGGGGCTGCGAGCCCGGCGG 0: 1
1: 0
2: 4
3: 31
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133784335 Original CRISPR GGCCGGGGCTGCGAGCCCGG CGG Exonic
900145550 1:1157461-1157483 GGGCGGGGCTGCGGGCGGGGCGG - Intergenic
900307854 1:2019700-2019722 GGCGGGGGCGGCCAGCGCGGGGG - Intronic
900366819 1:2314922-2314944 GGCGGGGGCTTCCGGCCCGGGGG + Intergenic
900393512 1:2443877-2443899 GGCGGGGGCTGCGGGCCGGGAGG - Intronic
900620507 1:3584861-3584883 GGATGGGGCTCCCAGCCCGGAGG + Intronic
901030641 1:6305222-6305244 GGACGGGGCGGCGGGCCGGGCGG + Intronic
901228502 1:7628975-7628997 GGCCAGGGCTGCATGCCCTGAGG + Intronic
901556095 1:10032735-10032757 CGCTGGGGCTGCGGGCGCGGCGG - Intergenic
901796072 1:11680532-11680554 GGCTGGACCTGCGGGCCCGGGGG - Intronic
901836337 1:11926273-11926295 GGGCTGGGCGGCGGGCCCGGCGG - Exonic
902348748 1:15837564-15837586 GGCCGGGGCAGCGCGCTGGGCGG + Intergenic
902603616 1:17556295-17556317 GGGCGGGCCTGGGAGCACGGGGG + Intronic
903034547 1:20485690-20485712 GGGCGGGGCCGCGAGCCGGGAGG + Exonic
903077913 1:20786673-20786695 GGCGGGGGCGGAGAACCCGGGGG + Exonic
903658705 1:24964162-24964184 GGCTGGGGCTGCAGGCCCTGGGG + Intronic
903750245 1:25616934-25616956 GGCCAGGGCTGCGCGCTCCGCGG + Intergenic
903924052 1:26819055-26819077 GGACGGGGCGGCTGGCCCGGCGG - Intergenic
904030031 1:27528007-27528029 GGCCAGGGCCGCCAGCCCCGGGG + Intergenic
904252995 1:29237853-29237875 GGCCGCGGCTGCGCCCCGGGCGG + Intronic
904753219 1:32754016-32754038 TCCCGGGGCTGCGGGCCCGGCGG + Intronic
905767374 1:40612627-40612649 GGCTGGGGCTGTGAGCTCAGAGG - Intergenic
905791382 1:40791514-40791536 GGCAGGAGCTGCGTGCCCTGGGG + Intronic
905803733 1:40861778-40861800 GGCGCCGGCTGCGGGCCCGGGGG + Exonic
906044498 1:42817315-42817337 GGGCGGGGCCGCGCGCCGGGGGG + Intronic
906199102 1:43947759-43947781 GGCCTGGGCTGGGTGCCCGCTGG + Intronic
906318009 1:44800513-44800535 GGCCGGGGGAGCGGGCGCGGCGG - Exonic
906365396 1:45205904-45205926 GGCCGGAGCGGCGGCCCCGGGGG + Exonic
906749020 1:48242319-48242341 GGCCAGGGCTGGGAGTCAGGAGG - Intronic
907406691 1:54258124-54258146 GGCGAGGGCTGTGACCCCGGAGG + Exonic
907451408 1:54547994-54548016 GGCTGGGGCTGGGTGCCCAGTGG + Intronic
910257035 1:85259112-85259134 GGTCGGGGCACCGAGCGCGGAGG + Intronic
910676611 1:89821785-89821807 GGGCTGCGCTGGGAGCCCGGCGG + Intronic
912514556 1:110210041-110210063 GGGAGGAGCTGCGGGCCCGGGGG + Intergenic
912798548 1:112707047-112707069 GGCCGGGGCTGCGGGCGGTGGGG - Intronic
913115397 1:115692097-115692119 AGCCAGGGCTGCCAGCCAGGTGG - Exonic
914197340 1:145454431-145454453 GCCCGGGGCGGCGGGGCCGGCGG - Intergenic
914888158 1:151600767-151600789 GGCCGGGGCGGCTGGCCGGGCGG - Intergenic
916179178 1:162069644-162069666 GGCGGGGCCTCTGAGCCCGGCGG + Intergenic
917582878 1:176396177-176396199 GGACGGGGCGGCTAGCCGGGCGG + Intergenic
920197819 1:204241322-204241344 GAGCTGGGCTGCGAGCCCAGGGG - Intronic
920703094 1:208232383-208232405 GGCCAGGGCTGAGAGCTGGGAGG - Intronic
921044091 1:211460877-211460899 GGACGGGGCTGCTGGCCGGGCGG - Intergenic
922219844 1:223550222-223550244 GGCCTGTGCTCCGAGCCCTGGGG + Intronic
924242864 1:242057238-242057260 GTCCGGGGCAGGGAGCCCAGGGG - Intergenic
924854002 1:247857681-247857703 GGCGGGGGCTGCGGGCGCTGCGG + Intronic
1062774787 10:135755-135777 GGCGGGGCCTGCGAGGGCGGCGG + Intronic
1062976597 10:1688276-1688298 GGCCAGGGCTGGGACCCCAGTGG + Intronic
1063202217 10:3794674-3794696 ACCCGGGGCTGGGAGCCCAGAGG + Intergenic
1063418233 10:5890290-5890312 GGCCGGCGGCGCGGGCCCGGCGG + Intronic
1063586730 10:7358987-7359009 GGCCAGAGCTGCGAGCACAGTGG + Intronic
1064230734 10:13528327-13528349 GGCCCTGCCTGCCAGCCCGGCGG + Intronic
1065055451 10:21837930-21837952 GGCCGGGGCGGCTGGCCGGGCGG - Intronic
1065214993 10:23439906-23439928 GACCGGGGCTGCGGGCGCCGGGG - Exonic
1067617036 10:47764011-47764033 GGCCGGGTCTGGGAGCCCTCAGG + Intergenic
1067769832 10:49115347-49115369 GGCCGGGGCTCCGGGCCTGGTGG - Intronic
1070327045 10:75396170-75396192 GGCCGGGGCGACAAGCCCGCCGG + Intergenic
1072253703 10:93601139-93601161 GGCCGGGGCCTCGGGGCCGGCGG - Intronic
1072680088 10:97499588-97499610 GGCCGGAGCTGCCAGGCCAGCGG - Intronic
1072781871 10:98256997-98257019 GCTCAGGGCTGCGAGCCTGGAGG + Intronic
1073178159 10:101569120-101569142 GGCCTGGGGAGGGAGCCCGGTGG + Intergenic
1074152093 10:110767314-110767336 GGACGGGGCGGCTAGCCGGGTGG + Intronic
1075031905 10:119029644-119029666 GGCCGCGGCGGCGAGGCCGGGGG + Intergenic
1075393805 10:122112891-122112913 GGCCGGGGAGGAGAGCGCGGCGG + Intronic
1076373951 10:129971499-129971521 CGCCTGGGCTGCGCACCCGGAGG + Intergenic
1076877120 10:133221360-133221382 GGCCTGGGGTGTGAGCCCTGTGG - Intronic
1077043679 11:535321-535343 GGCCGGGGGCGCGGGGCCGGCGG - Intronic
1077052933 11:575907-575929 GGGCGGGGCTGCGAGGGTGGGGG + Intergenic
1077053016 11:576118-576140 GGACGGGGCTGCGGGCGTGGGGG + Intergenic
1077359982 11:2136566-2136588 GGCTGGGGCTGCCCGCCTGGAGG - Intronic
1077360661 11:2139022-2139044 GCCCGAGGCTGCGCGCCGGGGGG + Intronic
1077370338 11:2178908-2178930 GGGCGAGGCTGGGTGCCCGGAGG - Intergenic
1077410889 11:2403413-2403435 GGCCGGGCCCGGGAGCCCAGAGG + Exonic
1077491178 11:2861754-2861776 GGCCGGGACTGGGAGCCCTGGGG - Intergenic
1077495744 11:2885819-2885841 GGCCGGGCCCGCGCGCACGGGGG - Exonic
1078246219 11:9574538-9574560 GGCCGGGGCCGCGGCGCCGGAGG + Intronic
1079332829 11:19547664-19547686 AGTGGGGGCTGAGAGCCCGGGGG + Intronic
1079710724 11:23679988-23680010 GGCCCGGGCTGCCAGTCCTGTGG - Intergenic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1081938140 11:46918598-46918620 GGCCGGGGCTGCGGCGCGGGGGG - Exonic
1081994584 11:47355211-47355233 GGCGGGGGCTGCGGGCTCAGTGG + Exonic
1082833842 11:57638462-57638484 GACCGAGGTTGCGAGGCCGGTGG - Intergenic
1083258115 11:61508876-61508898 GGCCGGGGCGGGGGGCCCGGGGG + Exonic
1083618120 11:64036227-64036249 GGCGGGGGCCGGGGGCCCGGGGG + Intronic
1083658503 11:64241582-64241604 AGGCGGGGCTGCAGGCCCGGGGG + Intronic
1083739754 11:64702193-64702215 GGACGGGGCGGCTGGCCCGGCGG - Intronic
1083782285 11:64924827-64924849 GGCCGGGACTGGGCGCTCGGCGG - Exonic
1083848968 11:65354584-65354606 GGGCGGGGCTTCTAGCGCGGAGG - Intergenic
1083882657 11:65556065-65556087 GGCCTGGGCACCGAGCCTGGGGG + Intronic
1084265665 11:68003992-68004014 GGCGGGGGCTGCGGGGCCGCAGG - Exonic
1084650919 11:70488710-70488732 AGCAGGGGCTGAGAGCCCAGTGG + Intronic
1084756529 11:71242560-71242582 GGTGGGGGCTGGGAGCCAGGGGG - Intronic
1084888381 11:72224673-72224695 GGCCCGGGCTGCGGGCCGAGCGG + Intronic
1085025891 11:73236427-73236449 GGCTGGGGCTGTGAGCCAGGGGG + Intergenic
1089378399 11:118011190-118011212 GCCCGGGGCTGGGAGCACGGAGG - Intergenic
1089522319 11:119073406-119073428 GGCCAGCTCTGCGAGCCTGGTGG - Intronic
1091650340 12:2304587-2304609 GGCAGGGGCTGCCTGCCCTGGGG - Intronic
1092240015 12:6830511-6830533 GGATGGGGCTGCGAGCCAGGGGG + Exonic
1092556344 12:9566355-9566377 GGCGGGGACTGAGAGCCAGGAGG + Intergenic
1092843357 12:12562987-12563009 GGTCGGGGCCGCGAGCCCGGGGG - Intergenic
1093525853 12:20102671-20102693 GGCTGGGGCTGCATGCCCTGTGG - Intergenic
1094515749 12:31124301-31124323 GGCGGGGACTGAGAGCCAGGAGG - Intergenic
1096039300 12:48500376-48500398 GGACGGGGCAGCTGGCCCGGCGG + Intergenic
1097222029 12:57456641-57456663 TGCCTGGGCTGCCAGCCAGGTGG - Exonic
1097891348 12:64780751-64780773 GGCCGGCGCCGCGAGGCGGGAGG + Intergenic
1101393342 12:104323378-104323400 GGCCGGGGCGGCTGGCCGGGCGG + Intronic
1101879554 12:108617039-108617061 GGCTGGGGCTGCCACCCTGGGGG - Intergenic
1102025970 12:109714498-109714520 CGCCCGCGCTGGGAGCCCGGCGG - Exonic
1102238619 12:111310141-111310163 GCCCGGGGCTGGGAGACAGGGGG - Exonic
1103563420 12:121804146-121804168 GGCCGGGGCGGCCGGACCGGGGG - Intergenic
1103595551 12:122022569-122022591 CGCCGGGGCCGCGATGCCGGCGG + Intronic
1103779580 12:123389597-123389619 GGCCGGGGCCGCGAGCACATGGG + Intronic
1103917061 12:124381213-124381235 GGCTGGGGCAGCGAGCAGGGAGG - Intronic
1104854301 12:131894894-131894916 GGCCGGGGGCGCGGGGCCGGGGG - Exonic
1104861681 12:131927499-131927521 GGGCGGGGCTCCAAGCCAGGGGG + Intergenic
1106057868 13:26254819-26254841 GGCCGAGGCAGGTAGCCCGGAGG + Intronic
1106422586 13:29595802-29595824 GGCGGCGGCTGCCAGCCCAGAGG + Intergenic
1107058501 13:36131197-36131219 GGCCGGGGCTGCGGGGCTGCAGG + Exonic
1109284894 13:60397676-60397698 GCCGGGGGCCGCGAGCCGGGCGG + Intronic
1110705941 13:78602181-78602203 GGCCCGGGCGGCGGCCCCGGGGG - Exonic
1112091755 13:96090663-96090685 GCCGGGGCCTGCGAGCCGGGCGG - Intergenic
1112415542 13:99200882-99200904 CTCTGGGGCTCCGAGCCCGGCGG + Exonic
1112509536 13:99997505-99997527 AGCCGGGCCTGCGGACCCGGTGG - Intergenic
1114165273 14:20212933-20212955 GGACGGGGCTGCTGGCCGGGCGG - Intergenic
1115609771 14:35039242-35039264 GGACGGGGCGGCTAGCCGGGCGG - Intergenic
1116467720 14:45253108-45253130 GGCCTGAGGCGCGAGCCCGGCGG - Exonic
1116817856 14:49599769-49599791 GGCCGGGGCGGGGATCCGGGCGG + Intronic
1116821721 14:49633916-49633938 GGCTGGGGCTGCGGGCTCCGGGG - Exonic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117548433 14:56811505-56811527 GCCCCGGGCTGCGAGCCCAGAGG + Intergenic
1119219369 14:72893596-72893618 GGCGGGGGCCGCGGGCTCGGGGG + Intronic
1119622119 14:76138952-76138974 GGCCCGGGCAGCGCGCGCGGGGG + Intergenic
1119701957 14:76761711-76761733 GGCGGGGACCGCAAGCCCGGAGG - Intergenic
1119702047 14:76762025-76762047 GGCGAAGGCTGCGAGCCCCGAGG - Intergenic
1121670921 14:95710212-95710234 GGCCAGGCCGGCGAGCCCTGTGG - Exonic
1122132724 14:99614476-99614498 GGCTGGGGCTGAGAGCCCAAGGG - Intergenic
1122174669 14:99908147-99908169 GGCAGGGGCCGCCAGCACGGGGG + Intronic
1122544167 14:102513100-102513122 GGCTGGGGCTGCAAGCACAGAGG + Intergenic
1122631682 14:103110127-103110149 GGCCGGGGCGGCGGGTGCGGAGG + Exonic
1122719702 14:103715377-103715399 GAGCCGGGCTGCGAGCCGGGCGG - Intronic
1122736642 14:103847407-103847429 GGCCGGGCCGGAGAGCACGGCGG - Exonic
1122835237 14:104427563-104427585 GGCCTCGGCTGCGTGGCCGGGGG - Intergenic
1122889686 14:104726521-104726543 GGGAGGTGCTGGGAGCCCGGTGG - Intronic
1122913161 14:104843602-104843624 GGCGGGGCAGGCGAGCCCGGGGG - Intergenic
1122917093 14:104864440-104864462 GGGCGGGGCAGCGTGCCCGAAGG - Intergenic
1122978599 14:105181225-105181247 GGCGGGGGCCGCGAGCTCTGCGG + Exonic
1123041032 14:105490323-105490345 TCCCGGGGCTGCGAGGACGGCGG - Intronic
1124238957 15:28014339-28014361 GCCTGGGGCTGTGTGCCCGGAGG - Intronic
1124250029 15:28101034-28101056 GGCTGGGGCACAGAGCCCGGGGG + Intergenic
1125070301 15:35546259-35546281 GATCGGCGCTGCGAGCCCCGCGG + Intergenic
1125329067 15:38564725-38564747 CGCCGGGGCTACGAGGCCCGGGG - Exonic
1128124898 15:65185168-65185190 GGCCGGGGCTTCGCCCCCTGAGG + Exonic
1128149738 15:65355501-65355523 GGGCGAGGGCGCGAGCCCGGAGG + Intronic
1128264351 15:66253857-66253879 GGAGGGAGCTGCGAGCCGGGAGG - Intergenic
1128582574 15:68819668-68819690 GGCCGGGGGTTCGAGCTGGGGGG + Intronic
1129192159 15:73943484-73943506 AGCAGGGGCAGTGAGCCCGGGGG + Intronic
1129823789 15:78621107-78621129 GGCCGGAGCACCCAGCCCGGCGG - Exonic
1130115307 15:81000963-81000985 GGCGGCGGCGGCGAGCCCGGGGG + Exonic
1130335331 15:82952820-82952842 GGCCGCGGCAGCGAGCCAAGAGG + Intronic
1130428213 15:83821972-83821994 GGACGGGGCTGCTGGCCGGGCGG + Intronic
1130531135 15:84748549-84748571 GGGCGGGGCTGCGGCTCCGGGGG - Intergenic
1131056317 15:89377446-89377468 GGCTGGGGCTGGGAGCCAAGGGG + Intergenic
1131367820 15:91854255-91854277 GGCCGGGGCTGCCAGCGAGCGGG + Intronic
1131515336 15:93073102-93073124 GGCGGGAGCAGCGAGCCGGGAGG + Intronic
1132519712 16:381643-381665 GGCCGGGGCTGCGGGCGGGGCGG - Intronic
1132568319 16:633279-633301 GGCCGGGGCTGGGATGCTGGGGG - Exonic
1132570545 16:642182-642204 CGCGGGGGCTGCGAGGTCGGCGG - Exonic
1132580819 16:683944-683966 GGCTGGGGCGGCGAGGCTGGCGG - Intronic
1132583044 16:694085-694107 GGGCGGGGCTGGGAGGGCGGAGG + Exonic
1132604566 16:788388-788410 GGGCGGGGCTGCGCGCGCAGCGG - Intronic
1132828937 16:1918286-1918308 GGCCTGGGCGGCGGGGCCGGGGG - Exonic
1132945924 16:2531495-2531517 GGGCAGGGCTGGGAGCCCAGCGG - Intergenic
1133220189 16:4316324-4316346 CGCCGGGGCTGCGGGGCCCGAGG + Intronic
1133311281 16:4848050-4848072 GGCCGGGTCCCCGAGCCCAGGGG - Intronic
1133784335 16:8963320-8963342 GGCCGGGGCTGCGAGCCCGGCGG + Exonic
1133784440 16:8963615-8963637 GGCCGGGGCTGCGGGGCCGCGGG + Intronic
1134531974 16:14990196-14990218 GGGCTGGGCGGCGGGCCCGGCGG - Intronic
1136220091 16:28823189-28823211 GGCCGGGGCTGGGGCCCCGCTGG - Exonic
1136233648 16:28902258-28902280 GGCTGTGGCTGGGAGCCCGTCGG - Exonic
1136377262 16:29872799-29872821 GGGAGGGGCCGGGAGCCCGGTGG + Intronic
1136413218 16:30089079-30089101 GGCCGGCGCTGGGAGCCCAGCGG - Exonic
1136413893 16:30092028-30092050 CGAGGGGGCTGCGAGGCCGGCGG + Intergenic
1136426283 16:30170117-30170139 GGACGGGGCGGCTGGCCCGGCGG - Intergenic
1137244953 16:46694612-46694634 GGCCGGGGCGGCTGGCCGGGCGG + Intronic
1138023383 16:53503740-53503762 GGGCGGCGCTGCGAGGCCCGAGG + Intronic
1138106479 16:54289604-54289626 AGCCGGGGCTGGGAGTCCGAGGG - Intergenic
1138598330 16:58041220-58041242 GGCAGGAGCTGCCAGCCCCGAGG - Intronic
1139785750 16:69390581-69390603 GGCCGGGCATGTGAACCCGGGGG + Intronic
1141679632 16:85536670-85536692 GGCAGGGGCTGGGAGCCAGAGGG - Intergenic
1142088270 16:88196237-88196259 GGCCAGGCCTGCTAGCCTGGTGG - Intergenic
1142147897 16:88500107-88500129 GGCCGGGGCAGGAAGCCGGGTGG - Intronic
1142253698 16:89003760-89003782 GGCTGGGACTGGGATCCCGGGGG + Intergenic
1142373319 16:89694833-89694855 GGCGGGGGCTGCGGGCGCAGAGG - Intronic
1142373331 16:89694867-89694889 GGCGGGGGCTGCGGGCGCAGAGG - Intronic
1142623681 17:1179809-1179831 GGCCGAAGTTGCGAGCGCGGAGG + Exonic
1142743003 17:1941607-1941629 GGGGGGGGATCCGAGCCCGGGGG + Intronic
1142939803 17:3371797-3371819 GGCCGGGGCGGCTGGCCGGGCGG + Intergenic
1142940814 17:3378609-3378631 GGCCAGGGCTGCGTGCTCGGTGG - Intergenic
1143078631 17:4365935-4365957 GGCCGGGGCCGCCAGCTTGGAGG - Intronic
1143206398 17:5143097-5143119 GGCCGGGGCGGCTGGCCGGGTGG - Intronic
1143390510 17:6556672-6556694 GGGCGGGGGTGCGGGCCCGCGGG - Intergenic
1143962120 17:10729730-10729752 GGGCGGAGCTGGGAGCCGGGCGG + Intronic
1144109739 17:12020633-12020655 GACCAGGGCTGCGGGCCCGCGGG - Intergenic
1144339792 17:14301833-14301855 CGAGGGCGCTGCGAGCCCGGAGG + Exonic
1144641931 17:16942291-16942313 GGCCGGTGCTCCAAGCCCGCGGG + Intronic
1144847298 17:18226520-18226542 GCCCGGGGCTCCGAGTCCAGGGG + Intronic
1145248349 17:21284349-21284371 CGCCGGGGCTGCGGGTCTGGGGG + Intergenic
1147134776 17:38428519-38428541 GGCCGGGGCTCCGGGCGGGGCGG - Exonic
1147142324 17:38466610-38466632 GGGAGGCGCTGCGGGCCCGGGGG - Exonic
1147215930 17:38899012-38899034 GGCGGGGGGTGTGAGCCAGGGGG - Intronic
1147315482 17:39618162-39618184 GGGCGGGGCCGCGCGCCGGGCGG + Intergenic
1147360655 17:39927574-39927596 GGCCGGAGCTGCCAGCGGGGAGG - Intronic
1147879775 17:43646148-43646170 GGCGCGGGCTGCCTGCCCGGCGG + Intronic
1147891523 17:43720769-43720791 GGCGGAGGCTGCCAGCACGGAGG - Intergenic
1148430775 17:47641859-47641881 GGCCGAGGCGGCGAGGCGGGTGG - Intergenic
1148463487 17:47851194-47851216 GGGCGGGGCCGCGAGTCCGGGGG - Intronic
1148563465 17:48619504-48619526 GGCCGGGGCTCCCGGCCTGGCGG - Intronic
1148603041 17:48908542-48908564 CGCCGGGGCGGCGGGCCCCGGGG + Exonic
1148632867 17:49125715-49125737 GGACGGGGCGGCCGGCCCGGCGG - Intergenic
1148636100 17:49150314-49150336 GGACGGGGCTGCTGGCCAGGCGG - Intronic
1150124642 17:62628157-62628179 GGCGGGGGAGGGGAGCCCGGGGG + Intronic
1150225666 17:63523279-63523301 GGGCGGGGCGCGGAGCCCGGCGG + Intergenic
1150790354 17:68197303-68197325 GGCCGGGGCCTGGAGCCGGGAGG - Intergenic
1151605308 17:75131716-75131738 GGCCGGAGCTGCGAGCTCTCGGG + Exonic
1151755856 17:76074907-76074929 GGCCGGGAACGCGAGCCAGGCGG + Exonic
1152425024 17:80214088-80214110 GGCCAGGGCTGCAAGCTCGTAGG + Intronic
1152552316 17:81035704-81035726 GGCCGGGGCGGCGGGGGCGGCGG + Intronic
1152552321 17:81035713-81035735 GGCGGGGGCGGCGGGCCCAGGGG + Intronic
1152554272 17:81045305-81045327 GGCTGGGGCTGGGGGCCCAGGGG + Intronic
1152605641 17:81288305-81288327 CGCGGGAGCTGTGAGCCCGGGGG + Intronic
1152675269 17:81636945-81636967 GGCCCGGGGCTCGAGCCCGGAGG - Exonic
1152675284 17:81636984-81637006 GGCCGGGTCTGCGAGGCCCTTGG - Exonic
1152689523 17:81711860-81711882 GGCCGGGGCTGAGCCCTCGGTGG + Intergenic
1152729039 17:81960974-81960996 GGCCGGGGGTGCCGGGCCGGGGG + Exonic
1152757325 17:82092458-82092480 GGCCAGGGCTGCCAGCCCCGAGG + Exonic
1152800225 17:82327366-82327388 GGCGGGGGCTGGGAGGCTGGGGG + Intronic
1154294539 18:13137177-13137199 GGCCGAGGCTGCGGTCGCGGTGG + Intergenic
1155956649 18:31960802-31960824 GGACGGGGCGGCTAGCCGGGCGG - Intergenic
1156213983 18:34977539-34977561 GGCAGGGGCTGCGCGCTTGGGGG + Intronic
1160745397 19:709003-709025 GGCCGGGGCTGCGCGGCGCGGGG - Intergenic
1160775433 19:853107-853129 GGCCGGGGCTGCTGGCGGGGGGG + Intronic
1160873183 19:1286133-1286155 GGCCGGGAGAGCGAGCGCGGCGG + Exonic
1160935481 19:1592653-1592675 GGCGGCGGCGGCGGGCCCGGCGG - Exonic
1161973504 19:7596433-7596455 GGCGGGGTCTGCGGGCCGGGTGG + Intronic
1162109082 19:8390553-8390575 GCCCGGGGCTTGGGGCCCGGCGG + Intronic
1162111913 19:8404014-8404036 GGTGGGCGCTGAGAGCCCGGGGG - Exonic
1162861109 19:13506313-13506335 TGCCGGGGCTGGGAGCGCGGCGG + Intronic
1162935330 19:13978997-13979019 GGCCGGGGCGGCGGCTCCGGCGG + Intronic
1162948534 19:14057542-14057564 TCCCGAGGCAGCGAGCCCGGCGG + Intronic
1163035186 19:14565699-14565721 GGGAGGGGCTGCCGGCCCGGAGG - Intronic
1163102716 19:15107730-15107752 GGCCGGGGATGCCAGCGCTGCGG + Intronic
1163370380 19:16897861-16897883 GGCCGGGGGTGCGGGCGCGCGGG + Intronic
1163427355 19:17246604-17246626 GGCCGGGGCCGCGAGGTCAGGGG + Intronic
1163441339 19:17323935-17323957 GGGCAGGGTTGCCAGCCCGGCGG - Intronic
1163720561 19:18896324-18896346 GGCCGGAGCTGGGGGCCCGTTGG + Intronic
1163786953 19:19279653-19279675 TGACGGGGCTGCGGGCCTGGAGG + Intronic
1164043171 19:21511230-21511252 GGACGGGGCGGCTGGCCCGGTGG + Intronic
1164298399 19:23937110-23937132 GGCCGGGGCGGCTGGCCGGGCGG + Intronic
1164958461 19:32406170-32406192 GGCCTGGGCTGCGACCCCGGCGG + Exonic
1165309245 19:35020741-35020763 GGCCAGGGCTCTGAGCCAGGAGG + Intronic
1165842622 19:38797967-38797989 GGCCGGGGCGGCTGGCCGGGCGG + Intergenic
1166072980 19:40397515-40397537 AGCCGGGGCTCCGAGCCCAAGGG + Exonic
1166306848 19:41940234-41940256 GGCGGGCGCGGGGAGCCCGGGGG + Intergenic
1166316786 19:41993946-41993968 GGCCAGGCCTGCGAGACCCGGGG - Intronic
1166878883 19:45914729-45914751 GGCTGGGGCTGGGGGCCCGTGGG + Exonic
1167042120 19:47028418-47028440 GGCGGGGGCTGCGCGCCCATGGG + Intronic
1167056082 19:47112385-47112407 GGCCGGGGCTGCGTCCCCGGGGG - Intronic
1167080391 19:47273578-47273600 GCCAGGGTCTGCGAGCCGGGCGG + Intergenic
1167540927 19:50086636-50086658 GGACGGGGCTGCTGGCCTGGCGG - Intergenic
1167643683 19:50695042-50695064 GGCCGGGGCTGGGGCCGCGGCGG - Intronic
1168146005 19:54420489-54420511 AGCCGGGGCTGGGAACCGGGAGG + Intronic
1168239646 19:55082608-55082630 GGGCGGGGCTGGGAGGCAGGGGG + Intronic
1168515157 19:57004635-57004657 GGCCGGGGTGGCGTGCCCGGTGG - Intergenic
925419899 2:3703562-3703584 GGACGGGGCTGCCAGGCGGGCGG - Intergenic
926718589 2:15942591-15942613 GGCCGGGTGGGCGAGCTCGGCGG - Exonic
927809550 2:26173650-26173672 GGCCGGGGCGGGGGGCCCAGGGG - Intronic
929966841 2:46542825-46542847 GGCCGGGGCGGGGATCCGGGCGG + Exonic
930847791 2:55923896-55923918 GCCCAGCGTTGCGAGCCCGGCGG + Exonic
932209483 2:69915268-69915290 GGCGGCGGCAGCGAGCCCGTGGG + Exonic
932331422 2:70900425-70900447 CGCCGGGGCTCCGCGCCAGGGGG - Intergenic
932699963 2:73985347-73985369 GGCGGGGGCTGCGAAGCCGCCGG + Intergenic
934771092 2:96907999-96908021 GGCCCGGGGTGCGAGCCAGGCGG - Intronic
935630654 2:105210745-105210767 GGACGGGGCGGCTGGCCCGGGGG + Intergenic
936412884 2:112275944-112275966 GGGCAGGTCTGCGAGGCCGGCGG - Exonic
936512185 2:113157418-113157440 GGCCTCGGCTGCGCGCGCGGGGG - Intronic
938014787 2:127858207-127858229 GGCCGGGAGTGCGAGCCGGACGG + Intergenic
938116642 2:128606946-128606968 GGCAGGGGCTGCCAGACCTGGGG + Intergenic
938273180 2:129993247-129993269 GGCGAGGGCTGTGACCCCGGAGG - Intergenic
938301120 2:130213693-130213715 GGCCGGGGCGGGGATCCTGGCGG - Intergenic
938455596 2:131460774-131460796 GGCCGGGGCGGGGATCCTGGCGG + Intergenic
941786734 2:169506017-169506039 GGACGGGGCGGCTAGCCGGGCGG - Exonic
942355706 2:175108429-175108451 GGACGGGGCTGCTGGCCGGGCGG - Intronic
943773576 2:191742429-191742451 GGACGGGGCTGCTGGCCGGGTGG - Intergenic
946360860 2:219218691-219218713 GGCCGAGGCTGCGGGCACTGCGG + Exonic
946865535 2:224038882-224038904 GGCCGGGGCTGGGTGCTCGCCGG - Intronic
947593055 2:231395921-231395943 GGCCGGCGCGGCGCGCGCGGGGG - Intronic
947603602 2:231469415-231469437 TGCAGGGGCTGGGAGCCTGGGGG - Intronic
948000475 2:234563006-234563028 GGACGGGGCGGCTAGCCAGGCGG - Intergenic
948140472 2:235669490-235669512 GGCGGCGGCGGCGAGCGCGGCGG - Intronic
948395741 2:237643631-237643653 GGCCAGGGCCCCCAGCCCGGTGG + Intronic
948942019 2:241201461-241201483 GGCCGAGGCCTGGAGCCCGGAGG + Intronic
949004581 2:241637843-241637865 GGCCGGGGCGGCGGGCGCTGCGG + Intronic
1169093174 20:2873635-2873657 GCCCGCGGCTCCGAGCCCCGCGG - Intronic
1169168136 20:3441371-3441393 GGCCGGGGCGGCTGGCCGGGCGG + Intergenic
1169200356 20:3706267-3706289 GGCTGGGGCTGAGAGCCAAGGGG + Intronic
1170558033 20:17531203-17531225 GGCTGGGGCAACGAGCCTGGCGG - Exonic
1170664562 20:18375682-18375704 GGACGGGGCGGCTGGCCCGGCGG + Intergenic
1170736213 20:19016049-19016071 GGCCAGGGCTGAGGGCCAGGAGG - Intergenic
1171249504 20:23637583-23637605 GGCCGGGGCTTCGGACCCTGCGG + Intronic
1172108052 20:32528330-32528352 GGCCTGGGCTGGGGTCCCGGGGG + Intronic
1172279987 20:33701610-33701632 GGACGGGGCGGCCAGCCGGGCGG - Intergenic
1172703031 20:36863983-36864005 GGCAGGGCCTGCGAGAGCGGCGG + Intergenic
1173251634 20:41366761-41366783 GGCCGGGCCAGCGAGCTCGGGGG - Exonic
1173548145 20:43914796-43914818 GAGCGGGACTGCGAGCGCGGGGG - Intergenic
1173865907 20:46312631-46312653 GGACGGGGCCGCCAGCCCGCCGG + Intergenic
1174218558 20:48935696-48935718 GGACGGGGCGGCTAGCCGGGCGG + Intronic
1174878300 20:54250487-54250509 GGACGGGGCGGCCAGCCGGGCGG + Intergenic
1175715481 20:61252342-61252364 AGCCGGGGCGGCGAGCGCGGCGG + Intergenic
1175800952 20:61800761-61800783 GGCCGGGGCTGGGAGACAGATGG + Intronic
1175847110 20:62065010-62065032 GGCGGGGGCGGCGGGCGCGGGGG + Exonic
1175903089 20:62367546-62367568 GACCTGGGCTGGGGGCCCGGCGG - Intergenic
1176113904 20:63422802-63422824 GGCTGGGGCAGCGAGCACGAGGG + Intronic
1176684352 21:9836064-9836086 CGCCAGGGCTACGAGGCCGGTGG - Intergenic
1176952763 21:15065340-15065362 GGACAGAGCTGGGAGCCCGGGGG - Intergenic
1176976493 21:15327149-15327171 GGCCTGGGCTGTTAGCCCTGTGG + Intergenic
1177262599 21:18750010-18750032 GGACTGGGCTGCCAGCTCGGTGG + Intergenic
1178922534 21:36747949-36747971 GGCCTGGCCTGCGCTCCCGGCGG + Exonic
1179411739 21:41168036-41168058 GGCCGGGGAGGCGGGCGCGGAGG - Exonic
1179631272 21:42680113-42680135 GGCAGGGGCCCTGAGCCCGGGGG - Intronic
1179911856 21:44455114-44455136 GGCGGGGTCTGCGCGCCGGGAGG - Intergenic
1179965323 21:44801614-44801636 GGCTGGGGCAGGGAGCCTGGCGG - Intronic
1180064454 21:45405512-45405534 AGCCAGGGCGGCGAGGCCGGCGG - Intronic
1180782802 22:18530104-18530126 GGCCGGCGCCGCGGGCGCGGAGG + Intronic
1180843797 22:18970903-18970925 GGCCGGGGGTGGCGGCCCGGGGG + Intergenic
1180921648 22:19524460-19524482 GGCCGGGGGGCCGGGCCCGGGGG - Exonic
1181057909 22:20268486-20268508 GGCCGGGGACGCGGGCCCGAGGG + Exonic
1181126364 22:20704136-20704158 GGCCGGCGCCGCGGGCGCGGAGG + Intergenic
1181165184 22:20979432-20979454 GGGCGGGGCTGGGAGCCTAGGGG + Intronic
1181239692 22:21469442-21469464 GGCCGGCGCCGCGGGCGCGGAGG + Intergenic
1181280591 22:21717128-21717150 GGCCGGGGCTGGGGGGGCGGGGG + Intronic
1181672746 22:24433307-24433329 GGGCCGGGCTGGGAGCCAGGCGG + Exonic
1182299182 22:29328478-29328500 TGCCGGGGCTGTGAGCCGGAGGG + Exonic
1182355434 22:29720542-29720564 CGCCGGGGCGGGGATCCCGGCGG - Intronic
1182729430 22:32475134-32475156 GGCCGGGGCTGGGCGGCCCGCGG + Intronic
1182976257 22:34626074-34626096 GGACGGGGCGGCAAGCCGGGCGG + Intergenic
1182982413 22:34684392-34684414 GGACGGGGCTGCTGGCCTGGCGG + Intergenic
1183411790 22:37659169-37659191 GGCCGGGGACCCGAGCGCGGGGG + Exonic
1183577402 22:38700772-38700794 TGTAGGGGCTGCGAGCCGGGTGG - Intronic
1183595412 22:38807572-38807594 GGACGGGGCGGCTAGCCGGGCGG - Intergenic
1184034175 22:41910754-41910776 GGCGGCGGCAGCCAGCCCGGGGG + Intronic
1184193128 22:42908417-42908439 GGCCTGGGCTGTGAGCCTTGGGG - Intronic
1184201371 22:42971814-42971836 GGACGGGGCTGCTGGCCGGGCGG - Intronic
1184444455 22:44539280-44539302 GGCAGGGGCTGAGAGCCCAGAGG - Intergenic
1184680759 22:46071244-46071266 GCCCGGGGCGGCGTGCCCGCGGG + Intronic
1184759405 22:46536466-46536488 GGCCGGCGCGACGGGCCCGGCGG - Exonic
1184810629 22:46829233-46829255 GGCCTGGGCTGTGAGCCCTCAGG + Intronic
1185039794 22:48498056-48498078 GGGTGGGGCTGCAAGCCTGGGGG + Intronic
1185039843 22:48498193-48498215 GGGTGGGGCTGCAAGCCTGGGGG + Intronic
1185278492 22:49960112-49960134 CGCCGGGGCTGCGAGGCTGGGGG + Intergenic
1185374143 22:50474557-50474579 GGCCGGGGCCGGGGGCCGGGCGG - Intronic
1185384339 22:50525025-50525047 GGCGTCGGCTGTGAGCCCGGAGG - Intronic
951013266 3:17704623-17704645 GGACGGGGCTGCTGGCCAGGCGG + Intronic
953397022 3:42581720-42581742 GGCCGGGACTGAGGGCCGGGTGG + Intronic
953464384 3:43105991-43106013 GGCGGTCGCTGCGAACCCGGCGG - Exonic
954110153 3:48429174-48429196 GGCCGGGGCCCCGATCCCGCCGG - Intronic
956605062 3:71065260-71065282 GGCCGGGGCTGCCGGCGGGGCGG + Intronic
956761299 3:72447206-72447228 GGCCGGCGCCGCGAGGGCGGAGG + Intergenic
959415667 3:106074772-106074794 GGACGGGGCTGCTGGCCGGGCGG + Intergenic
960026883 3:113019758-113019780 GGGCGGGGCCAGGAGCCCGGCGG + Exonic
960030014 3:113046517-113046539 GGACGGGGCTGCTGGCCGGGCGG + Intergenic
960030062 3:113046644-113046666 GGACGGGGCTGCTGGCCGGGCGG + Intergenic
961464610 3:127073533-127073555 GGCTGGCGCTGGGAGCCCTGGGG + Intergenic
961962435 3:130868136-130868158 GGCCGGGGCGGCTGGCCGGGCGG - Intronic
962222376 3:133574239-133574261 CGCGGGGGCTGCGGGCCCAGGGG + Exonic
962743612 3:138381530-138381552 GGGCGGGGCTGGGAGCCAGAGGG - Intronic
962786095 3:138769144-138769166 GGCCGGGGCTGCATGCTCTGTGG - Intronic
966253408 3:177891681-177891703 GGACGGGGCGGCTGGCCCGGCGG + Intergenic
968521889 4:1037831-1037853 GGCCGGGACTCCCAGCCCTGGGG - Intergenic
968571950 4:1346730-1346752 GGACCTGGCTGCGAGCCCGCGGG + Intergenic
968701199 4:2059079-2059101 GGCGGGGGCTCCTGGCCCGGGGG - Intergenic
968908221 4:3464112-3464134 GGCCTGGGCTGCCAGACCTGGGG - Intronic
969214593 4:5711614-5711636 AGCCGGGGCTCCGGGCCCGCAGG - Intronic
969394170 4:6909895-6909917 GGCCTGGGCTGCGGGCCCACGGG + Exonic
969404239 4:6978132-6978154 GGACGGGGCGGCTAGCCGGGCGG - Intronic
969604916 4:8197642-8197664 GGCCGGGCCGGGGAGCCTGGAGG + Intronic
970332879 4:15003241-15003263 GGCGGCGGCTTCGAGTCCGGAGG - Exonic
971294506 4:25376992-25377014 GGGCGGGGCAGGGAGCCCCGAGG - Intergenic
971406033 4:26321265-26321287 GGCGGCGGCGGCGAGGCCGGCGG + Intronic
972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG + Intergenic
972437141 4:39045038-39045060 GGCCGGGGCGGCCAGGCGGGAGG - Intronic
973159118 4:46993800-46993822 GTCGGGGGCTGCGAAGCCGGAGG - Exonic
974076622 4:57173380-57173402 GGACGGGGCTGCTGGCCAGGCGG - Intergenic
975661058 4:76689487-76689509 GGCCGGGGCAGCGCGGCTGGAGG - Intronic
978123577 4:105110329-105110351 GGACGGGGCTGCTGGCCGGGCGG - Intergenic
979475868 4:121157062-121157084 GCCCGGGTCCTCGAGCCCGGAGG - Intronic
981270871 4:142846348-142846370 ACCCGGGGCTGAGAACCCGGAGG + Intronic
981300901 4:143185086-143185108 GCCCGGGGCTGCTAGCCGGCGGG - Exonic
981478068 4:145208446-145208468 GGATGGGGCTGCGAGCCCACTGG + Intergenic
982075330 4:151731927-151731949 GGACGGGGCGGCTGGCCCGGCGG - Intronic
982615694 4:157636607-157636629 GGACGGGGCTGCTGGCCGGGCGG + Intergenic
983628790 4:169828570-169828592 GGACGGGGCGGCTGGCCCGGTGG - Intergenic
984804205 4:183736900-183736922 GGACGGGGCGGCCAGCCGGGCGG + Intergenic
984832397 4:183987700-183987722 TGCCCGGGCTGCGAGCCTGACGG + Intronic
985629932 5:1008981-1009003 AGCCGGGGCCGGGAGCCCGCGGG - Exonic
985660795 5:1155755-1155777 GGCCGGGGTCGGGGGCCCGGCGG + Intergenic
985808802 5:2068341-2068363 GGAAGGGGCTGCCAGCCCAGGGG + Intergenic
989567461 5:42915582-42915604 GGGCAGGGCTGCGTGCCCGGTGG - Intergenic
990545241 5:56815621-56815643 CGCCAGGGCTACGAGCCCTGAGG + Exonic
992574685 5:78097300-78097322 GGACGGGGCTGCTGGCCGGGCGG - Intronic
992910729 5:81393932-81393954 GACCGGGGCTGCGGGAGCGGCGG - Intronic
993904108 5:93604272-93604294 GGGAGGGGCGGCCAGCCCGGGGG + Intergenic
995052728 5:107724755-107724777 GGCCGGGGCTGCGGGCAGGTGGG - Intergenic
995193545 5:109342016-109342038 GGACGGGGCGGCTGGCCCGGCGG - Intronic
995693887 5:114858119-114858141 GGCCAGGCCTGGGTGCCCGGGGG - Intergenic
997201328 5:132011681-132011703 GGCGGGAGCTGCGGGGCCGGAGG - Intronic
997892366 5:137687303-137687325 GGACGGGGCAGCCAGCCGGGCGG - Intronic
997965520 5:138353016-138353038 GGCCGGGGCTGCGGGGCCTGCGG + Intronic
998007809 5:138668693-138668715 GGCCGGGGCAGAGGGCACGGGGG - Intronic
998286907 5:140871149-140871171 GGCGGGCGCCGCGAGCCCAGAGG + Exonic
999141742 5:149367045-149367067 GCCCAGGGCTGGGAGGCCGGGGG - Intronic
1001065114 5:168529685-168529707 GGCCGGGGCCGGGGGCGCGGCGG + Exonic
1001506530 5:172284164-172284186 GGGCGGGGCTGCGAGCGGAGCGG + Intergenic
1002021390 5:176366146-176366168 GGTCGGGACTCCGAGACCGGTGG + Intronic
1002211126 5:177600068-177600090 GGCCGGAGCGGCGGACCCGGCGG + Intergenic
1002328934 5:178428565-178428587 GGCAGGGGCTGCCAGCCAGGAGG - Intronic
1002512748 5:179733357-179733379 GGCCGGGGCGGCGGGCGCCGGGG - Exonic
1002527234 5:179821393-179821415 GGCCGGGGGCTCGAGCCTGGGGG + Intronic
1002939004 6:1699576-1699598 GGAAGGGGCTGCGAGCCAAGGGG - Intronic
1003111072 6:3252661-3252683 GGCCGGTGCTGTGAGTCAGGTGG + Intronic
1003212337 6:4079105-4079127 GGCCGGGGCTGCGGCTCCGCGGG + Exonic
1003290460 6:4775658-4775680 GGCCGGGGGTGGGATCCGGGGGG - Intronic
1003290632 6:4776162-4776184 GGGCGGGGCCGCGAGCGCGGGGG - Intronic
1003442695 6:6158580-6158602 GGCCGGGGATGGGAACCAGGAGG - Intronic
1003498794 6:6687203-6687225 GGGCGGGGCTCCCAGCCAGGAGG - Intergenic
1004414844 6:15415568-15415590 GGACGGGGCTGCTGGCCGGGCGG + Intronic
1005040392 6:21595367-21595389 GCCCGGGGCCGCGAGCGCTGCGG - Exonic
1005063475 6:21797268-21797290 GGACGGGGCGGCTAGCCGGGCGG + Intergenic
1005159008 6:22837144-22837166 GGACGGGGCGGCTGGCCCGGCGG - Intergenic
1006090204 6:31624283-31624305 GGCAGTGGCTGCGATTCCGGCGG - Exonic
1006313504 6:33277532-33277554 GGCGGGGGCTGGGAGCAGGGAGG - Exonic
1006624039 6:35384977-35384999 GGACGGGGCGGCTGGCCCGGCGG - Intronic
1006743135 6:36323368-36323390 AGCAGGGGCTGCCAGCCCAGAGG - Exonic
1007400452 6:41599748-41599770 GGCCTGGGCCGGGAGCCCAGGGG + Exonic
1007651506 6:43425342-43425364 GGACGGGGCAGCTAGCCGGGCGG - Intergenic
1013619285 6:111872877-111872899 GGCGGGGGCGGCGTGCGCGGGGG + Intronic
1013681272 6:112528312-112528334 GGCCGGGGCGGCTGGCCGGGCGG + Intergenic
1013793607 6:113860167-113860189 GGCCGCAGCTGCGCCCCCGGCGG - Exonic
1014272487 6:119349651-119349673 CGCCGGGGCTGCGGGACCGTGGG - Exonic
1015776767 6:136822631-136822653 GGCCGGGGCAGCGAGGGCCGGGG + Exonic
1015799274 6:137044477-137044499 GGCCGGAGCTTCCAGCCCCGGGG - Intronic
1017163794 6:151390325-151390347 GGCGGGGCCGGCGAGACCGGAGG - Intronic
1018669645 6:166167989-166168011 GGGCGGGTCTGGGAGGCCGGGGG + Intronic
1019159915 6:170062880-170062902 GGCCGGAGCTGGGAGCTGGGAGG - Intergenic
1019287933 7:232920-232942 GGCTGGGGCTGCAGGCCCAGAGG - Intronic
1019379264 7:712608-712630 GGCCGGGGTTGGGGGCCCCGCGG - Intronic
1019474335 7:1236727-1236749 GGCCGGGGCTGGGGCCCCCGGGG - Exonic
1019563364 7:1668489-1668511 GGCTGGGGCCCGGAGCCCGGTGG + Intergenic
1019575198 7:1734445-1734467 GCCCGGGGCTGCGAGCCCAGAGG + Intronic
1019714971 7:2534395-2534417 GGACGGGGCGGCTGGCCCGGCGG + Intergenic
1019981422 7:4624292-4624314 GGACGGGGCTGCTGGCCGGGCGG - Intergenic
1020093248 7:5353107-5353129 GGCAGGGGCTGGTAGCCTGGCGG - Intronic
1021101160 7:16586806-16586828 GGCCGGGGCTGGGGCCCCGCGGG + Intergenic
1021647413 7:22801091-22801113 GGACGGGGCTGCTGGCCGGGTGG - Intergenic
1022207573 7:28179712-28179734 GGCCGGGGACGCGGGCCCGGGGG - Intronic
1023405951 7:39833940-39833962 GGCGAGGGCTGTGACCCCGGAGG - Intergenic
1023951281 7:44848036-44848058 GGTCGGTGCTGCGAGAGCGGCGG - Exonic
1023955728 7:44885378-44885400 GGGCGGGGGCGCGAGCGCGGCGG - Intergenic
1026822182 7:73557275-73557297 GGGCGGGCCCGCGAGCCGGGAGG + Intronic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1026923709 7:74174467-74174489 GTCGGGGGCTGCGGGACCGGCGG + Intronic
1026941411 7:74289818-74289840 AAGCGGGGCTGCGGGCCCGGAGG + Intronic
1027421133 7:78019423-78019445 GGCCGGGCCCGCGACCCCCGGGG - Exonic
1028582597 7:92423040-92423062 GGCAGGGGCTGAGAGCCAGCAGG + Intergenic
1029151246 7:98482148-98482170 GGACGGGGCTGCCAGTCAGGAGG - Intergenic
1029206053 7:98869940-98869962 CGCCCGCGCTGCGCGCCCGGAGG - Intronic
1032238534 7:130143724-130143746 GGCTGGGGCTACGGGCCTGGTGG - Intergenic
1032525688 7:132577052-132577074 GGCCGGGGCTGGGGGGCCGCGGG + Exonic
1034361852 7:150506361-150506383 GGACGGGGCGGCGGGCCGGGCGG + Intergenic
1034977616 7:155457618-155457640 GGCCGAGGCGGCGAGGGCGGCGG + Intergenic
1035580862 8:738314-738336 GGGCTGGGCTGCGCGCACGGGGG + Intergenic
1036737223 8:11330118-11330140 GGACGGGGCTGCTGGCCGGGCGG - Intergenic
1037825197 8:22156519-22156541 TGGCGGGGCTGCGGGCCAGGGGG - Exonic
1037887915 8:22604815-22604837 GGCCAGGGCAGCGACACCGGGGG - Exonic
1038554212 8:28494856-28494878 AGCCGGGGCCGGGAGCCTGGCGG - Intronic
1038595145 8:28881140-28881162 GGACGGGGCGGCCAGCCGGGCGG - Intronic
1039608379 8:38901089-38901111 GGCGGGGGCGGGGCGCCCGGAGG - Intergenic
1039745540 8:40422827-40422849 GGCAGGGGCTGAGAGACAGGTGG + Intergenic
1040985054 8:53284997-53285019 TGCTGGGGCTGAGAGCCAGGTGG - Intergenic
1041355250 8:56993446-56993468 GGCCTGGGCGGCGAGCCTGGCGG - Exonic
1042136068 8:65634086-65634108 GGCCGGGGCTGCGAACCGAAGGG - Exonic
1049177324 8:141202199-141202221 GGACGGGGCGGCTGGCCCGGCGG + Intergenic
1049194515 8:141308107-141308129 GGCCGGGGCCGCGGGGGCGGCGG + Intronic
1049216290 8:141409841-141409863 GGCCGTGGCTGGGTGCCCAGCGG + Intronic
1049266354 8:141669956-141669978 GGACGTGGCTGAGATCCCGGCGG - Intergenic
1049268338 8:141681385-141681407 GGCCTGGGGTGGGAGCCCGCAGG - Intergenic
1049482755 8:142834744-142834766 GGGCGGGGCTGTGCGGCCGGCGG + Intronic
1049557328 8:143289526-143289548 GGGCGGGGCTGCTGGCCCTGCGG + Intergenic
1049574854 8:143385269-143385291 GGGCGAGGCTGCGAGGCTGGGGG + Intergenic
1049600852 8:143506907-143506929 GGCCGTGGCTGCTCGCCCTGAGG + Intronic
1049789403 8:144465982-144466004 GGGCGGGGCTGCGAGGAGGGGGG + Intergenic
1049828564 8:144685609-144685631 GGCCGGCGCTGCGGTCCCCGTGG - Intergenic
1052295480 9:26892635-26892657 GTCCGGGGCCGCGAGCGCTGCGG + Exonic
1053048189 9:34937040-34937062 GGACGGGGCGGCTGGCCCGGGGG - Intergenic
1053294576 9:36903527-36903549 AGCAGGGGCTGAGAGCCCTGAGG + Intronic
1053457502 9:38242782-38242804 GGACGGGGCTGCTGGCCGGGTGG - Intergenic
1054835594 9:69672359-69672381 GGGTGGGGCCGCGAGACCGGAGG - Intergenic
1055397541 9:75891077-75891099 GCCCGGGGCTGCTCGCCGGGCGG + Exonic
1058019039 9:100068408-100068430 GGACGGGGCGGCTGGCCCGGCGG - Intronic
1058439198 9:104991727-104991749 CGCCGCGGCTGGGAGTCCGGAGG - Intergenic
1060200934 9:121651554-121651576 GGCGGGGGCTGGGGACCCGGAGG - Intronic
1060283499 9:122228893-122228915 GGCCGGGGCTGCGCGCGGGCCGG - Intronic
1060700568 9:125746844-125746866 GGCGGGGGCGCTGAGCCCGGAGG - Intergenic
1061151128 9:128828970-128828992 GGCAGGGGCCGGGAGCCCTGGGG - Intronic
1061391956 9:130321661-130321683 AGCCAGGACTGAGAGCCCGGGGG - Intronic
1061726118 9:132582839-132582861 GGGCGGGGCTGCCCGCGCGGTGG - Exonic
1062190820 9:135247013-135247035 GGCCGGGGCTGGCAGCCCCAGGG - Intergenic
1062574558 9:137200206-137200228 GGCCGGGGCGGCGCGGGCGGCGG + Exonic
1062696342 9:137877994-137878016 GCCCGGGGCGGCGGGGCCGGCGG + Exonic
1062707346 9:137952921-137952943 GGCCAGGGTGGCGAGCCCAGTGG - Intronic
1185880549 X:3736213-3736235 GGCTGGGGCAGAGAGCCCTGGGG - Intergenic
1186244854 X:7608780-7608802 GGACGGGGCAGCTAGCCGGGCGG + Intergenic
1190839127 X:54129135-54129157 GGCCGGGGCGGCTGGCCTGGCGG + Intronic
1196804736 X:119574380-119574402 GGGCGGGGCCGCGAGCGCAGAGG - Intergenic
1197736052 X:129850889-129850911 GGACGGGGCTGCTGGCCGGGCGG - Intergenic
1200163250 X:154019788-154019810 GGCCGGGGGGCCGGGCCCGGGGG - Exonic
1200249763 X:154546809-154546831 CTTCGGGGCTGCGAGCGCGGAGG - Exonic
1200784604 Y:7249139-7249161 GGCTGGGGCAGAGAGCCCTGGGG + Intergenic
1201291190 Y:12421581-12421603 AGCCGGCGCTGGGGGCCCGGAGG + Intergenic
1202195609 Y:22296285-22296307 GGCTGGGGCTGAGAGGCCTGTGG + Intergenic