ID: 1133787879

View in Genome Browser
Species Human (GRCh38)
Location 16:8986979-8987001
Sequence GGGAGTGCATGAAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133787879_1133787885 12 Left 1133787879 16:8986979-8987001 CCTACTTCCCTTCATGCACTCCC No data
Right 1133787885 16:8987014-8987036 CTCCTCATCAGCATCTCCCTTGG No data
1133787879_1133787886 13 Left 1133787879 16:8986979-8987001 CCTACTTCCCTTCATGCACTCCC No data
Right 1133787886 16:8987015-8987037 TCCTCATCAGCATCTCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133787879 Original CRISPR GGGAGTGCATGAAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr