ID: 1133788297

View in Genome Browser
Species Human (GRCh38)
Location 16:8989762-8989784
Sequence ATCTGGGTGTGGCAGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133788297_1133788304 8 Left 1133788297 16:8989762-8989784 CCCTCTGGCTGCCACACCCAGAT No data
Right 1133788304 16:8989793-8989815 CATCCCAAGCAGAGACCTGGTGG No data
1133788297_1133788303 5 Left 1133788297 16:8989762-8989784 CCCTCTGGCTGCCACACCCAGAT No data
Right 1133788303 16:8989790-8989812 GGACATCCCAAGCAGAGACCTGG No data
1133788297_1133788308 17 Left 1133788297 16:8989762-8989784 CCCTCTGGCTGCCACACCCAGAT No data
Right 1133788308 16:8989802-8989824 CAGAGACCTGGTGGGCACAGTGG No data
1133788297_1133788305 9 Left 1133788297 16:8989762-8989784 CCCTCTGGCTGCCACACCCAGAT No data
Right 1133788305 16:8989794-8989816 ATCCCAAGCAGAGACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133788297 Original CRISPR ATCTGGGTGTGGCAGCCAGA GGG (reversed) Intergenic
No off target data available for this crispr