ID: 1133788303

View in Genome Browser
Species Human (GRCh38)
Location 16:8989790-8989812
Sequence GGACATCCCAAGCAGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133788294_1133788303 29 Left 1133788294 16:8989738-8989760 CCAGTGGAAAGGAAGAGGCTCCA No data
Right 1133788303 16:8989790-8989812 GGACATCCCAAGCAGAGACCTGG No data
1133788300_1133788303 -6 Left 1133788300 16:8989773-8989795 CCACACCCAGATGCTCAGGACAT No data
Right 1133788303 16:8989790-8989812 GGACATCCCAAGCAGAGACCTGG No data
1133788296_1133788303 9 Left 1133788296 16:8989758-8989780 CCATCCCTCTGGCTGCCACACCC No data
Right 1133788303 16:8989790-8989812 GGACATCCCAAGCAGAGACCTGG No data
1133788297_1133788303 5 Left 1133788297 16:8989762-8989784 CCCTCTGGCTGCCACACCCAGAT No data
Right 1133788303 16:8989790-8989812 GGACATCCCAAGCAGAGACCTGG No data
1133788298_1133788303 4 Left 1133788298 16:8989763-8989785 CCTCTGGCTGCCACACCCAGATG No data
Right 1133788303 16:8989790-8989812 GGACATCCCAAGCAGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133788303 Original CRISPR GGACATCCCAAGCAGAGACC TGG Intergenic
No off target data available for this crispr