ID: 1133788305

View in Genome Browser
Species Human (GRCh38)
Location 16:8989794-8989816
Sequence ATCCCAAGCAGAGACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133788302_1133788305 -8 Left 1133788302 16:8989779-8989801 CCAGATGCTCAGGACATCCCAAG No data
Right 1133788305 16:8989794-8989816 ATCCCAAGCAGAGACCTGGTGGG No data
1133788296_1133788305 13 Left 1133788296 16:8989758-8989780 CCATCCCTCTGGCTGCCACACCC No data
Right 1133788305 16:8989794-8989816 ATCCCAAGCAGAGACCTGGTGGG No data
1133788298_1133788305 8 Left 1133788298 16:8989763-8989785 CCTCTGGCTGCCACACCCAGATG No data
Right 1133788305 16:8989794-8989816 ATCCCAAGCAGAGACCTGGTGGG No data
1133788297_1133788305 9 Left 1133788297 16:8989762-8989784 CCCTCTGGCTGCCACACCCAGAT No data
Right 1133788305 16:8989794-8989816 ATCCCAAGCAGAGACCTGGTGGG No data
1133788300_1133788305 -2 Left 1133788300 16:8989773-8989795 CCACACCCAGATGCTCAGGACAT No data
Right 1133788305 16:8989794-8989816 ATCCCAAGCAGAGACCTGGTGGG No data
1133788301_1133788305 -7 Left 1133788301 16:8989778-8989800 CCCAGATGCTCAGGACATCCCAA No data
Right 1133788305 16:8989794-8989816 ATCCCAAGCAGAGACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133788305 Original CRISPR ATCCCAAGCAGAGACCTGGT GGG Intergenic
No off target data available for this crispr