ID: 1133790946

View in Genome Browser
Species Human (GRCh38)
Location 16:9008798-9008820
Sequence GGGGGTGTCCACCGCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133790938_1133790946 12 Left 1133790938 16:9008763-9008785 CCACGCACTCCAGAACGTGCGGC No data
Right 1133790946 16:9008798-9008820 GGGGGTGTCCACCGCAGTCCTGG No data
1133790936_1133790946 13 Left 1133790936 16:9008762-9008784 CCCACGCACTCCAGAACGTGCGG No data
Right 1133790946 16:9008798-9008820 GGGGGTGTCCACCGCAGTCCTGG No data
1133790935_1133790946 21 Left 1133790935 16:9008754-9008776 CCATCGCACCCACGCACTCCAGA No data
Right 1133790946 16:9008798-9008820 GGGGGTGTCCACCGCAGTCCTGG No data
1133790940_1133790946 3 Left 1133790940 16:9008772-9008794 CCAGAACGTGCGGCTGGCTCAGA No data
Right 1133790946 16:9008798-9008820 GGGGGTGTCCACCGCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133790946 Original CRISPR GGGGGTGTCCACCGCAGTCC TGG Intergenic
No off target data available for this crispr