ID: 1133792803

View in Genome Browser
Species Human (GRCh38)
Location 16:9022243-9022265
Sequence CCTCTGTCATTTATCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133792803_1133792808 6 Left 1133792803 16:9022243-9022265 CCTGTGTTGATAAATGACAGAGG No data
Right 1133792808 16:9022272-9022294 TTGGTACCATGCCACCCTCCAGG No data
1133792803_1133792818 30 Left 1133792803 16:9022243-9022265 CCTGTGTTGATAAATGACAGAGG No data
Right 1133792818 16:9022296-9022318 CCGTAGCTCAGGTGTGGAGAGGG No data
1133792803_1133792815 24 Left 1133792803 16:9022243-9022265 CCTGTGTTGATAAATGACAGAGG No data
Right 1133792815 16:9022290-9022312 CCAGGACCGTAGCTCAGGTGTGG No data
1133792803_1133792811 19 Left 1133792803 16:9022243-9022265 CCTGTGTTGATAAATGACAGAGG No data
Right 1133792811 16:9022285-9022307 ACCCTCCAGGACCGTAGCTCAGG No data
1133792803_1133792816 29 Left 1133792803 16:9022243-9022265 CCTGTGTTGATAAATGACAGAGG No data
Right 1133792816 16:9022295-9022317 ACCGTAGCTCAGGTGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133792803 Original CRISPR CCTCTGTCATTTATCAACAC AGG (reversed) Intergenic
No off target data available for this crispr