ID: 1133802041

View in Genome Browser
Species Human (GRCh38)
Location 16:9092045-9092067
Sequence ATGGAGGAGCGGAAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2848
Summary {0: 1, 1: 1, 2: 13, 3: 246, 4: 2587}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133802033_1133802041 -4 Left 1133802033 16:9092026-9092048 CCGCGGGAGGCCGCGGAGGATGG 0: 1
1: 0
2: 3
3: 73
4: 747
Right 1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG 0: 1
1: 1
2: 13
3: 246
4: 2587
1133802024_1133802041 29 Left 1133802024 16:9091993-9092015 CCTGAGGAGGACGCGGCGGCGGT 0: 1
1: 0
2: 4
3: 19
4: 219
Right 1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG 0: 1
1: 1
2: 13
3: 246
4: 2587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133802041 Original CRISPR ATGGAGGAGCGGAAGGAGGA GGG Exonic
Too many off-targets to display for this crispr