ID: 1133804548

View in Genome Browser
Species Human (GRCh38)
Location 16:9114743-9114765
Sequence GAATATAGATTACACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133804541_1133804548 29 Left 1133804541 16:9114691-9114713 CCTTTTTGCTAAAATACTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1133804548 16:9114743-9114765 GAATATAGATTACACTTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133804548 Original CRISPR GAATATAGATTACACTTGGG TGG Intronic
904366608 1:30014893-30014915 GAATCTAGAGTCCACTGGGGAGG + Intergenic
905843369 1:41204969-41204991 GAAAATACATTATACTTGGATGG + Intronic
905923755 1:41735760-41735782 GAATTTAGATAGCACGTGGGTGG - Intronic
907947926 1:59152867-59152889 GAATAAAGGGAACACTTGGGAGG - Intergenic
909222087 1:72978143-72978165 AAATATAGACTACACTTTTGAGG + Intergenic
909722104 1:78785407-78785429 GGATATTGTTTACATTTGGGTGG + Intergenic
910036633 1:82796750-82796772 GGATATAGACTACACTTGAGTGG - Intergenic
918704743 1:187646364-187646386 GAATATAGATGACATATAGGAGG + Intergenic
919964042 1:202503348-202503370 GAATACAGAATACATTTGGTGGG + Intronic
921370446 1:214417825-214417847 GAATGAAGATTTCACTTGTGGGG - Intronic
922487904 1:225989983-225990005 GAAGATAGCTTAAACCTGGGAGG + Intronic
923505468 1:234601696-234601718 AAATATAGTTTACATTTTGGGGG - Intergenic
923550592 1:234959986-234960008 GAACATAGCATACACTTGGTGGG - Intergenic
1064202741 10:13298790-13298812 TAATACAAATTACACTTGGGAGG + Intronic
1064391811 10:14948836-14948858 GAATAGAGGTTACCTTTGGGAGG + Intronic
1064543932 10:16433022-16433044 GAAAATAGATTAAACCTGGGAGG - Intergenic
1064880569 10:20048376-20048398 GAATATAGAAAAAACTGGGGTGG - Intronic
1069264526 10:66441756-66441778 GGAAATAGATAACATTTGGGTGG + Intronic
1070143082 10:73753371-73753393 AAAAATAGTTTACACTTGGCTGG + Intronic
1071206253 10:83282803-83282825 GAGTATATATTACATTTGGTCGG + Intergenic
1082277729 11:50239710-50239732 GAAAATTGATTAAACCTGGGAGG - Intergenic
1088178465 11:107081749-107081771 GAAATTAGATGACACTTTGGGGG - Intergenic
1091964933 12:4732053-4732075 GAATATATATTACATTGGGAGGG - Intronic
1093124400 12:15311147-15311169 GAAAATGAATGACACTTGGGGGG - Intronic
1095041523 12:37447102-37447124 GAATATAGATTTCATGTGGCCGG + Intergenic
1096964410 12:55613951-55613973 GAATATATATTGCATGTGGGAGG - Intergenic
1097396156 12:59077347-59077369 TAAAACAGATTACACCTGGGAGG - Intergenic
1099874682 12:88390349-88390371 GAACATAGATTACAATTGAGGGG - Intergenic
1100210588 12:92394688-92394710 GAATATAGAATAATCATGGGTGG + Intergenic
1101196340 12:102386654-102386676 GCATATAGATTAGACTGGGGTGG + Intergenic
1101813049 12:108124054-108124076 GAAGAGTGGTTACACTTGGGTGG - Intergenic
1104902219 12:132195623-132195645 GAATATAGCTTGAACCTGGGAGG - Intergenic
1107609168 13:42095588-42095610 GAATATAGAAGAAAATTGGGAGG - Intronic
1109665081 13:65523935-65523957 AAAAATAGACTTCACTTGGGAGG + Intergenic
1109944006 13:69407788-69407810 GAATTTAGTTTAGACTTAGGTGG - Intergenic
1110317518 13:74128295-74128317 GCATATAAATTACACTTATGGGG - Intronic
1110729901 13:78867752-78867774 AAATATAGATTCCACACGGGGGG + Intergenic
1110837297 13:80098556-80098578 AAATAAATATAACACTTGGGAGG + Intergenic
1111216868 13:85154974-85154996 GAAAATAGAGTACTTTTGGGGGG - Intergenic
1112615626 13:101002071-101002093 GAATGTAGCTTACAATGGGGAGG + Intergenic
1113299104 13:108997199-108997221 GAATATCGTTTAAACCTGGGAGG + Intronic
1113400208 13:109985521-109985543 GAATATATATTACTCTAAGGGGG + Intergenic
1118985468 14:70750830-70750852 GAAAAAAAATTATACTTGGGAGG - Intronic
1120512464 14:85432572-85432594 GACTATAGATTAAATGTGGGTGG + Intergenic
1120642825 14:87036220-87036242 GAATATAGATGACTGTTGAGTGG + Intergenic
1121068357 14:90991610-90991632 GAAAATAGCTTGAACTTGGGAGG + Intronic
1121610865 14:95278181-95278203 GAATATTGGTTTCACCTGGGAGG + Intronic
1125852540 15:42918528-42918550 GAATTTAAATTTCACTTTGGTGG - Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1131755788 15:95559627-95559649 GAAAATTGATTTCACTGGGGTGG - Intergenic
1133804548 16:9114743-9114765 GAATATAGATTACACTTGGGTGG + Intronic
1135158895 16:20075945-20075967 GAATAGAGATTTCAATAGGGAGG - Intergenic
1141001116 16:80309133-80309155 GAATAAACATTACACATGGGAGG + Intergenic
1142576558 17:912694-912716 GCATGAAGATTACATTTGGGAGG + Intronic
1142976995 17:3651182-3651204 GATAATTGATTAAACTTGGGAGG - Intronic
1147964229 17:44185338-44185360 GAATAGTGATTACTCTTTGGAGG + Intergenic
1150258668 17:63770896-63770918 GAAAATTGCTTAAACTTGGGAGG + Intronic
1154227141 18:12515728-12515750 GGATATAGGTTACTCTAGGGAGG - Intronic
1155816409 18:30316782-30316804 GAATATAGTTTACATTTTGGAGG + Intergenic
1156285617 18:35692465-35692487 GAATATAGTTTAGACTTACGTGG - Intronic
1156583632 18:38408425-38408447 AATTATAGATTAGATTTGGGTGG - Intergenic
1156893175 18:42213669-42213691 GAATATAGCAGACACTTGGTTGG + Intergenic
1158051404 18:53225220-53225242 GACTATAGATTATATTTGTGAGG + Intronic
1162665781 19:12210641-12210663 GAGAATAGATTGAACTTGGGAGG - Intergenic
1164451051 19:28365095-28365117 GAAAATCGATTGAACTTGGGAGG + Intergenic
1165990948 19:39813258-39813280 GAATGTAGATTCCGCTTCGGTGG - Intergenic
1166549098 19:43653323-43653345 GGATCTAGATTACACTGGAGGGG + Intronic
1167943316 19:52964852-52964874 CAAAATAGATTACAATTGGATGG - Intergenic
927527958 2:23765112-23765134 GCATATAAATTTCACTAGGGTGG + Intronic
929883948 2:45862155-45862177 GAAGAAAGGTTACACTAGGGTGG - Intronic
930634914 2:53793701-53793723 AAATAGTGATTATACTTGGGAGG - Intronic
934050592 2:88207329-88207351 GAAAATCGCTTACACTTGGGAGG - Intergenic
935493027 2:103744128-103744150 GAATATTGTGTACACTGGGGTGG - Intergenic
935847041 2:107177210-107177232 GAAAATAGAGAACACTTGGAAGG - Intergenic
936128517 2:109812644-109812666 GAATATAGATTACAAATAGTAGG + Intronic
936216180 2:110558841-110558863 GAATATAGATTACAAATAGTAGG - Intronic
936425321 2:112413421-112413443 GAATATAGATTACAAATAGTAGG - Intronic
937501157 2:122480666-122480688 GAATATAAATGACATTTGGCTGG - Intergenic
938024927 2:127939316-127939338 GAAGATTGCTTGCACTTGGGAGG + Intergenic
939414426 2:141875699-141875721 AAATATAGACTACCCTTGTGGGG - Intronic
939614830 2:144350454-144350476 CAATATGGTTTCCACTTGGGTGG - Intergenic
940258005 2:151752358-151752380 AAAAGTAGATAACACTTGGGAGG - Intergenic
940834083 2:158501042-158501064 GATTTTAGATTAGACTTGGCAGG + Intronic
943503702 2:188725618-188725640 GAATACAGATTACACTTTTTTGG - Intergenic
943683551 2:190792849-190792871 GAAAATAGCTTAAACCTGGGAGG + Intergenic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
945034269 2:205690688-205690710 GAAAATCGCTTAAACTTGGGAGG + Intronic
945546292 2:211156297-211156319 GAATACATATTCCACTTTGGGGG - Intergenic
947309216 2:228782082-228782104 GAATATTGATTGAACCTGGGAGG - Intergenic
1171571731 20:26257884-26257906 GAATATAGATTTCATGTGGCCGG - Intergenic
1171804972 20:29669150-29669172 GAATATAGATTTCATGTGGCCGG - Intergenic
1180689141 22:17696536-17696558 GAATACAGACTTTACTTGGGAGG + Intronic
1182186677 22:28410750-28410772 GAATTTAGAATACATTTGTGAGG + Intronic
1183229255 22:36570671-36570693 GAAGATAGCTTCAACTTGGGAGG + Intronic
1184179211 22:42808306-42808328 GAAAATCGCTTAAACTTGGGAGG + Intronic
951462282 3:22964066-22964088 GAATATAAATTTCAGATGGGTGG + Intergenic
952238352 3:31503839-31503861 GAATATAGAATACATTTTGAAGG + Intergenic
952573390 3:34744769-34744791 GAACATAGTTTATACTTGGTTGG + Intergenic
956085059 3:65599196-65599218 GAAGCTAGATTACAAATGGGTGG + Intronic
957594706 3:82247740-82247762 GAGAATATCTTACACTTGGGAGG + Intergenic
959150034 3:102597397-102597419 GAAAATAGCTTGAACTTGGGAGG - Intergenic
959194917 3:103167425-103167447 GAAAAGAAAGTACACTTGGGAGG - Intergenic
959588435 3:108048709-108048731 AAATATTAATGACACTTGGGGGG + Intronic
959779323 3:110209462-110209484 GAATATAGATAAAAATTGTGGGG + Intergenic
961626911 3:128270489-128270511 GAATATAGACTTGATTTGGGAGG - Intronic
962090650 3:132240956-132240978 GAATATATGTTGCATTTGGGAGG + Intronic
963469174 3:145716697-145716719 GAATATATTCTACACATGGGAGG - Intergenic
966770033 3:183495651-183495673 GTATATAGATTAACCTAGGGAGG - Intronic
967174656 3:186852331-186852353 GAATAGAGATTAGACAGGGGAGG + Intronic
969964544 4:10980447-10980469 TAATAAAGATTATAGTTGGGAGG - Intergenic
970176442 4:13344402-13344424 GAATAAAGTTTACACTTCGAAGG + Intergenic
973332673 4:48925347-48925369 GAGTACAGAGAACACTTGGGTGG + Intergenic
975137666 4:70890171-70890193 GAATATAGCTTGAACTAGGGAGG + Intergenic
975939895 4:79630017-79630039 TAATAGAGAAAACACTTGGGAGG - Intergenic
977249234 4:94670875-94670897 GAATATAAATTACAGCTGAGGGG + Intergenic
977529487 4:98183329-98183351 GAGAATAGCTTAAACTTGGGAGG - Intergenic
978827675 4:113044350-113044372 GAATAGAGATTACTCATGGGAGG + Intronic
979339255 4:119501398-119501420 GAGAATAGCTTAAACTTGGGAGG - Intronic
982135113 4:152267874-152267896 TACTATAGATTAAACTTGGAGGG + Intergenic
982157836 4:152538778-152538800 GAATAATGACTACACTTAGGAGG - Intergenic
982401826 4:154976775-154976797 GAATATCGCTTGAACTTGGGAGG - Intergenic
983106012 4:163687188-163687210 GAATTTACATTGAACTTGGGGGG - Intronic
986872558 5:12067313-12067335 GAATGTAGATCACAGTTGGAGGG + Intergenic
987568728 5:19627577-19627599 GAATATATATTACTCTTGATTGG - Intronic
992107478 5:73461922-73461944 TAATATAGATTACGGTGGGGTGG + Intergenic
992111025 5:73494012-73494034 GAAAATGGATTATAGTTGGGAGG - Intergenic
993825715 5:92683819-92683841 GAATACAGATGACACTTTTGCGG - Intergenic
997108543 5:131048441-131048463 GAAAATTGATTGAACTTGGGAGG + Intergenic
999925650 5:156373432-156373454 AAATATAGGTTAGCCTTGGGCGG - Intronic
1002006778 5:176240327-176240349 GAAAATGGACAACACTTGGGAGG - Intronic
1002219598 5:177670309-177670331 GAAAATGGACAACACTTGGGAGG + Intergenic
1002512283 5:179729384-179729406 GCATTTATATTCCACTTGGGAGG + Exonic
1003576699 6:7303235-7303257 GAAAATCGATTAAACCTGGGAGG + Intronic
1006077328 6:31542225-31542247 GAATAAAGATAACAGTGGGGGGG - Exonic
1008925344 6:56886166-56886188 GAATATAGATTCCATTTGACTGG - Intronic
1009360110 6:62801103-62801125 GAATATAGCAGATACTTGGGTGG + Intergenic
1010132209 6:72507336-72507358 AATTCGAGATTACACTTGGGTGG + Intergenic
1010888667 6:81276096-81276118 GAAGACAGTTTACACTTGGTCGG + Intergenic
1011802595 6:91034452-91034474 GAATATGGAATACATTTTGGGGG + Intergenic
1012633513 6:101504536-101504558 CAATATAAATTATACTAGGGTGG + Intronic
1014587800 6:123222298-123222320 GTATATAGATTACACTCTGAGGG - Intronic
1014885773 6:126779520-126779542 GAACAAAGACTACACTTGGGTGG + Intergenic
1015541047 6:134314325-134314347 GCATAAAGATTTCACTTGGTTGG + Intronic
1017160257 6:151359248-151359270 AAAAATAGAATACACTTTGGGGG - Intergenic
1019405038 7:878666-878688 GAATATAGCTTGAACTCGGGAGG - Intronic
1020501407 7:8926165-8926187 GAAATTATATTTCACTTGGGTGG - Intergenic
1021767787 7:23966823-23966845 GAATATAAACCACCCTTGGGAGG + Intergenic
1022155356 7:27656031-27656053 GAATATATACTACACATGAGGGG + Intronic
1025242883 7:57292822-57292844 GAATACAGATAAAACTTGGCCGG + Intergenic
1025287597 7:57678722-57678744 GAATATAGATTTCATGTGGCCGG + Intergenic
1025771298 7:64509974-64509996 TAATTTAGAATACACTTGAGGGG - Intergenic
1025949378 7:66131648-66131670 GAATATAGATAAAATTTCGGAGG - Intronic
1031782791 7:125991204-125991226 GAAAATAGCTTGAACTTGGGAGG - Intergenic
1033495377 7:141888730-141888752 GAAAATATATCACACTTGGCCGG - Intergenic
1034763708 7:153697228-153697250 GAAAATAGCTTGAACTTGGGGGG - Intergenic
1035471672 7:159113764-159113786 GATGATAAATTATACTTGGGTGG + Intronic
1040745312 8:50635025-50635047 GAATGTATTTTACATTTGGGAGG - Intronic
1042409903 8:68452688-68452710 GAATATTTTTTCCACTTGGGGGG + Intronic
1043208403 8:77477168-77477190 GAATAATGATTACACTGGGTAGG + Intergenic
1044024808 8:87155502-87155524 GAATATGGAATACACATAGGAGG + Intronic
1044198341 8:89404527-89404549 GATTATTGATTTCACCTGGGAGG + Intergenic
1044362909 8:91309675-91309697 GAAAATAAAGTACACTTGGGAGG + Intronic
1046953304 8:120038501-120038523 GGATATAGCTTGAACTTGGGAGG + Intronic
1052202154 9:25796109-25796131 GAATATTGTTTCCACTTTGGTGG - Intergenic
1189528053 X:41847565-41847587 AAATATAGCTCACACTTTGGGGG - Intronic
1189958697 X:46304959-46304981 GAATAAAAATTCCACTTTGGGGG + Intergenic
1191237353 X:58144835-58144857 GAGTATTGATTGAACTTGGGGGG - Intergenic
1198218205 X:134576007-134576029 GAAGATAGATTACCAGTGGGGGG - Intronic
1200669811 Y:6074628-6074650 AAATATATATTACACTAGTGGGG + Intergenic